Target Regulator(s) Information (MicroRNA)
Target General Information | |||||
---|---|---|---|---|---|
Target ID | T75243 | Target Info | |||
Target Name | Serine/threonine-protein kinase mTOR (mTOR) | ||||
Synonyms | Target of rapamycin; TOR kinase; Rapamycin target protein 1; Rapamycin target protein; Rapamycin and FKBP12 target 1; RAPT1; RAFT1; Mechanistic target of rapamycin; Mammalian target of rapamycin; FRAP2; FRAP1; FRAP; FKBP12-rapamycin complex-associated protein; FKBP-rapamycin associated protein; FK506-binding protein 12-rapamycin complex-associated protein 1 | ||||
Target Type | Successful Target | ||||
Gene Name | MTOR | ||||
Biochemical Class | Kinase | ||||
UniProt ID | |||||
The microRNAs (miRNAs) Regulating This Target | |||||
miRNA Mature ID | hsa-miR-99a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacccguagauccgaucuugug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Mammalian target of rapamycin (mTOR) was further characterized as the direct target of miR-99a. | [15] | |||
Evidence Score (E-score) | 17 | + | |||
1 | ChIP; Immunohistochemistry; Immunoprecipitation; qRT-PCR; Western Blot | [1] | |||
2 | Immunoblot; Luciferase Reporter Assay; qRT-PCR | [2] | |||
3 | Immunohistochemistry; qRT-PCR; Western Blot | [3] | |||
4 | Luciferase Reporter Assay | [4] | |||
5 | Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot | [5] | |||
6 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [6] | |||
7 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [7] | |||
8 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [8] | |||
9 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [9] | |||
10 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [10] | |||
11 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [11] | |||
12 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [12] | |||
13 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [13] | |||
14 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [14] | |||
15 | Luciferase Reporter Assay; Western Blot | [15] | |||
16 | Luciferase Reporter Assay; Western Blot | [16] | |||
17 | Reporter Assay; Western Blot | [17] | |||
Representative Target(s) Regulated by This miRNA | Endothelial plasminogen activator inhibitor (SERPINE1) | Target Info | |||
Fibroblast growth factor receptor 3 (FGFR3) | Target Info | ||||
miRNA Mature ID | hsa-miR-100-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacccguagauccgaacuugug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | mTOR gene was a direct target of miR-100. siRNA-mediated mTOR knockdown phenocopied the effect of miR-100 in bladder cancer cell lines. | [15] | |||
Evidence Score (E-score) | 6 | + | |||
1 | Luciferase Reporter Assay | [18] | |||
2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [15] | |||
3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [8] | |||
4 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [10] | |||
5 | qRT-PCR; Western Blot | [19] | |||
6 | Western Blot | [20] | |||
Representative Target(s) Regulated by This miRNA | ATM serine/threonine kinase (ATM) | Target Info | |||
Bone morphogenetic protein receptor (BMPR2) | Target Info | ||||
miRNA Mature ID | hsa-miR-144-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uacaguauagaugauguacu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | mTOR is a direct target of miR-144. | [22] | |||
Evidence Score (E-score) | 3 | + | |||
1 | Immunofluorescence; Western Blot | [21] | |||
2 | Luciferase Reporter Assay | [22] | |||
3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [23] | |||
Representative Target(s) Regulated by This miRNA | ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) | Target Info | |||
Amyloid beta A4 protein (APP) | Target Info | ||||
miRNA Mature ID | hsa-miR-99b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cacccguagaaccgaccuugcg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-99a/b negatively regulated mTOR expression by binding to the 3'UTR, thereby resulting in suppression of cervical cancer cell proliferation and invasion. | [6] | |||
Evidence Score (E-score) | 3 | + | |||
1 | Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot | [24] | |||
2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [13] | |||
3 | Luciferase Reporter Assay; Western Blot | [6] | |||
Representative Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Target Info | |||
NADPH oxidase 4 (NOX4) | Target Info | ||||
miRNA Mature ID | hsa-let-7c-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugagguaguagguuguaugguu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miRNAs let-7 targets the mTOR mRNA. | [25] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [25] | |||
2 | qRT-PCR | [26] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-xL (BCL-xL) | Target Info | |||
Caspase-3 (CASP3) | Target Info | ||||
miRNA Mature ID | hsa-miR-193a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugggucuuugcgggcgagauga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | mTOR is a direct target of miR-193a-5p. | [27] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [27] | |||
2 | Western Blot | [27] | |||
Representative Target(s) Regulated by This miRNA | AP-2 transcription factor (TFAP2A) | Target Info | |||
Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
miRNA Mature ID | hsa-miR-496 | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugaguauuacauggccaaucuc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miRNA-496 targets 2 sites within the mTOR 3'UTR. | [28] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [28] | |||
2 | RT-PCR | [29] | |||
Representative Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Target Info | |||
miRNA Mature ID | hsa-miR-125a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ucccugagacccuuuaaccuguga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Transfection with miR-125a-5p resulted in decreased potein and mRNA level of mTOR. | [30] | |||
Evidence Score (E-score) | 1 | + | |||
1 | qRT-PCR; Western Blot | [30] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator BAK (BAK) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-196b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagguaguuuccuguuguuggg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Upregulation of miR-196b promotes the proliferation and invasion ability of gastric cancer cells by regulating the PI3K/AKT/mTOR pathway. | [31] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Western Blot | [31] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis mediating surface antigen FAS (FAS) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-224-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ucaagucacuagugguuccguuuag | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | mTOR was a direct target of mIR-224. | [32] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [32] | |||
Representative Target(s) Regulated by This miRNA | APJ endogenous ligand (Apelin) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-373-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | gaagugcuucgauuuuggggugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-373 increased the expression of MMP9 by directly targeting the 3'UTR of mTOR and suppressing their translation. | [33] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [33] | |||
Representative Target(s) Regulated by This miRNA | B-cell translocation gene 1 protein (BTG1) | Target Info | |||
Cell surface protein HB15 (CD83) | Target Info | ||||
miRNA Mature ID | hsa-miR-497-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cagcagcacacugugguuugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-497 targets the mTOR. | [34] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [34] | |||
Representative Target(s) Regulated by This miRNA | Angiomotin (AMOT) | Target Info | |||
Apoptosis inhibitor survivin (BIRC5) | Target Info | ||||
miRNA Mature ID | hsa-miR-520c-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aaagugcuuccuuuuagagggu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-520 increased the expression of MMP9 by directly targeting the 3'UTR of mTOR and suppressing their translation. | [33] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [33] | |||
Representative Target(s) Regulated by This miRNA | Amyloid beta A4 protein (APP) | Target Info | |||
Extracellular matrix receptor III (CD44) | Target Info | ||||
miRNA Mature ID | hsa-miR-199a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | acaguagucugcacauugguua | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The downregulation of miR-199a-3p by Anti-miRNA resulted in the changed protein level of target mTOR. | [35] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Western Blot; Luciferase Reporter Assay | [35] | |||
Representative Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Target Info | |||
miRNA Mature ID | hsa-miR-3188 | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agaggcuuugugcggauacgggg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-3188 directly targets mTOR. | [36] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Immunohistochemistry; Luciferase Reporter Assay; Western Blot | [36] | |||
Representative Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Target Info | |||
References | |||||
REF 1 | Long noncoding RNA ANRIL indicates a poor prognosis of gastric cancer and promotes tumor growth by epigenetically silencing of miR-99a/miR-449a. Oncotarget. 2014 Apr 30;5(8):2276-92. | ||||
REF 2 | miR-99a directly targets the mTOR signalling pathway in breast cancer side population cells. Cell Prolif. 2014 Dec;47(6):587-95. | ||||
REF 3 | PLGA-based dual targeted nanoparticles enhance miRNA transfection efficiency in hepatic carcinoma. Sci Rep. 2017 Apr 7;7:46250. | ||||
REF 4 | A dual PI3K/AKT/mTOR signaling inhibitor miR-99a suppresses endometrial carcinoma. Am J Transl Res. 2016 Feb 15;8(2):719-31. | ||||
REF 5 | MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells. PLoS One. 2013 Dec 3;8(12):e80625. | ||||
REF 6 | miR-99a and -99b inhibit cervical cancer cell proliferation and invasion by targeting mTOR signaling pathway. Med Oncol. 2014 May;31(5):934. | ||||
REF 7 | MiR-99a antitumor activity in human breast cancer cells through targeting of mTOR expression. PLoS One. 2014 Mar 17;9(3):e92099. | ||||
REF 8 | MicroRNA-100/99a, deregulated in acute lymphoblastic leukaemia, suppress proliferation and promote apoptosis by regulating the FKBP51 and IGF1R/mTOR signalling pathways. Br J Cancer. 2013 Oct 15;109(8):2189-98. | ||||
REF 9 | Clinic significance of microRNA-99a expression in human lung adenocarcinoma. J Surg Oncol. 2013 Sep;108(4):248-55. | ||||
REF 10 | MicroRNA-99a/100 promotes apoptosis by targeting mTOR in human esophageal squamous cell carcinoma. Med Oncol. 2013 Mar;30(1):411. | ||||
REF 11 | MicroRNA-99a induces G1-phase cell cycle arrest and suppresses tumorigenicity in renal cell carcinoma. BMC Cancer. 2012 Nov 23;12:546. | ||||
REF 12 | Downregulation of microRNA 99a in oral squamous cell carcinomas contributes to the growth and survival of oral cancer cells. Mol Med Rep. 2012 Sep;6(3):675-81. | ||||
REF 13 | MIR-99a and MIR-99b modulate TGF- induced epithelial to mesenchymal plasticity in normal murine mammary gland cells. PLoS One. 2012;7(1):e31032. | ||||
REF 14 | MicroRNA-99a inhibits hepatocellular carcinoma growth and correlates with prognosis of patients with hepatocellular carcinoma. J Biol Chem. 2011 Oct 21;286(42):36677-85. | ||||
REF 15 | Regulation of insulin-like growth factor-mammalian target of rapamycin signaling by microRNA in childhood adrenocortical tumors. Cancer Res. 2010 Jun 1;70(11):4666-75. | ||||
REF 16 | Insulin promotes glucose consumption via regulation of miR-99a/mTOR/PKM2 pathway. PLoS One. 2013 Jun 10;8(6):e64924. | ||||
REF 17 | MicroRNA-mediated downregulation of mTOR/FGFR3 controls tumor growth induced by Src-related oncogenic pathways. Oncogene. 2011 Aug 11;30(32):3489-501. | ||||
REF 18 | miRNA-100 inhibits human bladder urothelial carcinogenesis by directly targeting mTOR. Mol Cancer Ther. 2013 Feb;12(2):207-19. | ||||
REF 19 | MicroRNA 100: a context dependent miRNA in prostate cancer. Clinics (Sao Paulo). 2013 Jun;68(6):797-802. | ||||
REF 20 | MicroRNA 100 sensitizes luminal A breast cancer cells to paclitaxel treatment in part by targeting mTOR. Oncotarget. 2016 Feb 2;7(5):5702-14. | ||||
REF 21 | MicroRNA-144-3p inhibits proliferation and induces apoptosis of human salivary adenoid carcinoma cells via targeting of mTOR. Biotechnol Lett. 2016 Mar;38(3):409-16. | ||||
REF 22 | Downregulation of miR-144 is associated with colorectal cancer progression via activation of mTOR signaling pathway. Carcinogenesis. 2012 Dec;33(12):2391-7. | ||||
REF 23 | MiR-144 inhibits cell proliferation of renal cell carcinoma by targeting MTOR. J Huazhong Univ Sci Technolog Med Sci. 2016 Apr;36(2):186-192. | ||||
REF 24 | miRNA-99b-5p suppresses liver metastasis of colorectal cancer by down-regulating mTOR. Oncotarget. 2015 Sep 15;6(27):24448-62. | ||||
REF 25 | microRNA-mediated regulation of mTOR complex components facilitates discrimination between activation and anergy in CD4 T cells. J Exp Med. 2014 Oct 20;211(11):2281-95. | ||||
REF 26 | MicroRNAs as biomarkers for major depression: a role for let-7b and let-7c. Transl Psychiatry. 2016 Aug 2;6(8):e862. | ||||
REF 27 | MicroRNA-193a-3p and -5p suppress the metastasis of human non-small-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene. 2015 Jan 22;34(4):413-23. | ||||
REF 28 | microRNA-496 - A new, potentially aging-relevant regulator of mTOR. Cell Cycle. 2016;15(8):1108-16. | ||||
REF 29 | miR-496, miR-1185, miR-654, miR-3183 and miR-495 are downregulated in colorectal cancer cells and have putative roles in the mTOR pathway. Oncol Lett. 2019 Aug;18(2):1657-1668. | ||||
REF 30 | miR-125a inhibits the migration and invasion of liver cancer cells via suppression of the PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2015 Aug;10(2):681-686. | ||||
REF 31 | miR-196b regulates gastric cancer cell proliferation and invasion via PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2016 Mar;11(3):1745-1749. | ||||
REF 32 | MicroRNA-224 aggrevates tumor growth and progression by targeting mTOR in gastric cancer. Int J Oncol. 2016 Sep;49(3):1068-80. | ||||
REF 33 | miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-B factor in human fibrosarcoma cells. J Cell Physiol. 2012 Feb;227(2):867-76. | ||||
REF 34 | MiR-497 decreases cisplatin resistance in ovarian cancer cells by targeting mTOR/P70S6K1. Oncotarget. 2015 Sep 22;6(28):26457-71. | ||||
REF 35 | MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res. 2010 Jun 15;70(12):5184-93. | ||||
REF 36 | miR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3K/AKT-c-JUN. Nat Commun. 2016 Apr 20;7:11309. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.