Target Regulator(s) Information (MicroRNA)

Target General Information
Target ID	T75243		Target Info
Target Name	Serine/threonine-protein kinase mTOR (mTOR)
Synonyms	Target of rapamycin; TOR kinase; Rapamycin target protein 1; Rapamycin target protein; Rapamycin and FKBP12 target 1; RAPT1; RAFT1; Mechanistic target of rapamycin; Mammalian target of rapamycin; FRAP2; FRAP1; FRAP; FKBP12-rapamycin complex-associated protein; FKBP-rapamycin associated protein; FK506-binding protein 12-rapamycin complex-associated protein 1
Target Type	Successful Target
Gene Name	MTOR
Biochemical Class	Kinase
UniProt ID	P42345
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID	hsa-miR-99a-5p		miRNA Info
miRNA Mature AC	MIMAT0000097
Sequence	aacccguagauccgaucuugug
miRNA Species	Homo sapiens
Regulation Mechanism	Mammalian target of rapamycin (mTOR) was further characterized as the direct target of miR-99a.		[15]
Evidence Score (E-score)	17		+
1	ChIP; Immunohistochemistry; Immunoprecipitation; qRT-PCR; Western Blot		[1]
2	Immunoblot; Luciferase Reporter Assay; qRT-PCR		[2]
3	Immunohistochemistry; qRT-PCR; Western Blot		[3]
4	Luciferase Reporter Assay		[4]
5	Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot		[5]
6	Luciferase Reporter Assay; qRT-PCR; Western Blot		[6]
7	Luciferase Reporter Assay; qRT-PCR; Western Blot		[7]
8	Luciferase Reporter Assay; qRT-PCR; Western Blot		[8]
9	Luciferase Reporter Assay; qRT-PCR; Western Blot		[9]
10	Luciferase Reporter Assay; qRT-PCR; Western Blot		[10]
11	Luciferase Reporter Assay; qRT-PCR; Western Blot		[11]
12	Luciferase Reporter Assay; qRT-PCR; Western Blot		[12]
13	Luciferase Reporter Assay; qRT-PCR; Western Blot		[13]
14	Luciferase Reporter Assay; qRT-PCR; Western Blot		[14]
15	Luciferase Reporter Assay; Western Blot		[15]
16	Luciferase Reporter Assay; Western Blot		[16]
17	Reporter Assay; Western Blot		[17]
Representative Target(s) Regulated by This miRNA	Endothelial plasminogen activator inhibitor (SERPINE1)	Target Info	PAI1_HUMAN
Representative Target(s) Regulated by This miRNA	Fibroblast growth factor receptor 3 (FGFR3)	Target Info	FGFR3_HUMAN
miRNA Mature ID	hsa-miR-100-5p		miRNA Info
miRNA Mature AC	MIMAT0000098
Sequence	aacccguagauccgaacuugug
miRNA Species	Homo sapiens
Regulation Mechanism	mTOR gene was a direct target of miR-100. siRNA-mediated mTOR knockdown phenocopied the effect of miR-100 in bladder cancer cell lines.		[15]
Evidence Score (E-score)	6		+
1	Luciferase Reporter Assay		[18]
2	Luciferase Reporter Assay; qRT-PCR; Western Blot		[15]
3	Luciferase Reporter Assay; qRT-PCR; Western Blot		[8]
4	Luciferase Reporter Assay; qRT-PCR; Western Blot		[10]
5	qRT-PCR; Western Blot		[19]
6	Western Blot		[20]
Representative Target(s) Regulated by This miRNA	ATM serine/threonine kinase (ATM)	Target Info	ATM_HUMAN
Representative Target(s) Regulated by This miRNA	Bone morphogenetic protein receptor (BMPR2)	Target Info	BMPR2_HUMAN
miRNA Mature ID	hsa-miR-144-3p		miRNA Info
miRNA Mature AC	MIMAT0000436
Sequence	uacaguauagaugauguacu
miRNA Species	Homo sapiens
Regulation Mechanism	mTOR is a direct target of miR-144.		[22]
Evidence Score (E-score)	3		+
1	Immunofluorescence; Western Blot		[21]
2	Luciferase Reporter Assay		[22]
3	Luciferase Reporter Assay; qRT-PCR; Western Blot		[23]
Representative Target(s) Regulated by This miRNA	ADAM metallopeptidase with thrombospondin 1 (ADAMTS1)	Target Info	ATS1_HUMAN
Representative Target(s) Regulated by This miRNA	Amyloid beta A4 protein (APP)	Target Info	A4_HUMAN
miRNA Mature ID	hsa-miR-99b-5p		miRNA Info
miRNA Mature AC	MIMAT0000689
Sequence	cacccguagaaccgaccuugcg
miRNA Species	Homo sapiens
Regulation Mechanism	miR-99a/b negatively regulated mTOR expression by binding to the 3'UTR, thereby resulting in suppression of cervical cancer cell proliferation and invasion.		[6]
Evidence Score (E-score)	3		+
1	Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot		[24]
2	Luciferase Reporter Assay; qRT-PCR; Western Blot		[13]
3	Luciferase Reporter Assay; Western Blot		[6]
Representative Target(s) Regulated by This miRNA	Insulin-like growth factor I receptor (IGF1R)	Target Info	IGF1R_HUMAN
Representative Target(s) Regulated by This miRNA	NADPH oxidase 4 (NOX4)	Target Info	NOX4_HUMAN
miRNA Mature ID	hsa-let-7c-5p		miRNA Info
miRNA Mature AC	MIMAT0000064
Sequence	ugagguaguagguuguaugguu
miRNA Species	Homo sapiens
Regulation Mechanism	miRNAs let-7 targets the mTOR mRNA.		[25]
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay		[25]
2	qRT-PCR		[26]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-xL (BCL-xL)	Target Info	B2CL1_HUMAN
Representative Target(s) Regulated by This miRNA	Caspase-3 (CASP3)	Target Info	CASP3_HUMAN
miRNA Mature ID	hsa-miR-193a-5p		miRNA Info
miRNA Mature AC	MIMAT0004614
Sequence	ugggucuuugcgggcgagauga
miRNA Species	Homo sapiens
Regulation Mechanism	mTOR is a direct target of miR-193a-5p.		[27]
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay; Western Blot		[27]
2	Western Blot		[27]
Representative Target(s) Regulated by This miRNA	AP-2 transcription factor (TFAP2A)	Target Info	AP2A_HUMAN
Representative Target(s) Regulated by This miRNA	Erbb2 tyrosine kinase receptor (HER2)	Target Info	ERBB2_HUMAN
miRNA Mature ID	hsa-miR-496		miRNA Info
miRNA Mature AC	MIMAT0002818
Sequence	ugaguauuacauggccaaucuc
miRNA Species	Homo sapiens
Regulation Mechanism	miRNA-496 targets 2 sites within the mTOR 3'UTR.		[28]
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay		[28]
2	RT-PCR		[29]
Representative Target(s) Regulated by This miRNA	Serine/threonine-protein kinase mTOR (mTOR)	Target Info	MTOR_HUMAN
miRNA Mature ID	hsa-miR-125a-5p		miRNA Info
miRNA Mature AC	MIMAT0000443
Sequence	ucccugagacccuuuaaccuguga
miRNA Species	Homo sapiens
Regulation Mechanism	Transfection with miR-125a-5p resulted in decreased potein and mRNA level of mTOR.		[30]
Evidence Score (E-score)	1		+
1	qRT-PCR; Western Blot		[30]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator BAK (BAK)	Target Info	BAK_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
miRNA Mature ID	hsa-miR-196b-5p		miRNA Info
miRNA Mature AC	MIMAT0001080
Sequence	uagguaguuuccuguuguuggg
miRNA Species	Homo sapiens
Regulation Mechanism	Upregulation of miR-196b promotes the proliferation and invasion ability of gastric cancer cells by regulating the PI3K/AKT/mTOR pathway.		[31]
Evidence Score (E-score)	1		+
1	Western Blot		[31]
Representative Target(s) Regulated by This miRNA	Apoptosis mediating surface antigen FAS (FAS)	Target Info	TNR6_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
miRNA Mature ID	hsa-miR-224-5p		miRNA Info
miRNA Mature AC	MIMAT0000281
Sequence	ucaagucacuagugguuccguuuag
miRNA Species	Homo sapiens
Regulation Mechanism	mTOR was a direct target of mIR-224.		[32]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay; Western Blot		[32]
Representative Target(s) Regulated by This miRNA	APJ endogenous ligand (Apelin)	Target Info	APEL_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
miRNA Mature ID	hsa-miR-373-3p		miRNA Info
miRNA Mature AC	MIMAT0000726
Sequence	gaagugcuucgauuuuggggugu
miRNA Species	Homo sapiens
Regulation Mechanism	miR-373 increased the expression of MMP9 by directly targeting the 3'UTR of mTOR and suppressing their translation.		[33]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay; Western Blot		[33]
Representative Target(s) Regulated by This miRNA	B-cell translocation gene 1 protein (BTG1)	Target Info	BTG1_HUMAN
Representative Target(s) Regulated by This miRNA	Cell surface protein HB15 (CD83)	Target Info	CD83_HUMAN
miRNA Mature ID	hsa-miR-497-5p		miRNA Info
miRNA Mature AC	MIMAT0002820
Sequence	cagcagcacacugugguuugu
miRNA Species	Homo sapiens
Regulation Mechanism	miR-497 targets the mTOR.		[34]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay; Western Blot		[34]
Representative Target(s) Regulated by This miRNA	Angiomotin (AMOT)	Target Info	AMOT_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis inhibitor survivin (BIRC5)	Target Info	BIRC5_HUMAN
miRNA Mature ID	hsa-miR-520c-3p		miRNA Info
miRNA Mature AC	MIMAT0002846
Sequence	aaagugcuuccuuuuagagggu
miRNA Species	Homo sapiens
Regulation Mechanism	miR-520 increased the expression of MMP9 by directly targeting the 3'UTR of mTOR and suppressing their translation.		[33]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay; Western Blot		[33]
Representative Target(s) Regulated by This miRNA	Amyloid beta A4 protein (APP)	Target Info	A4_HUMAN
Representative Target(s) Regulated by This miRNA	Extracellular matrix receptor III (CD44)	Target Info	CD44_HUMAN
miRNA Mature ID	hsa-miR-199a-3p		miRNA Info
miRNA Mature AC	MIMAT0000232
Sequence	acaguagucugcacauugguua
miRNA Species	Homo sapiens
Regulation Mechanism	The downregulation of miR-199a-3p by Anti-miRNA resulted in the changed protein level of target mTOR.		[35]
Evidence Score (E-score)	1		+
1	Western Blot; Luciferase Reporter Assay		[35]
Representative Target(s) Regulated by This miRNA	Serine/threonine-protein kinase mTOR (mTOR)	Target Info	MTOR_HUMAN
miRNA Mature ID	hsa-miR-3188		miRNA Info
miRNA Mature AC	MIMAT0015070
Sequence	agaggcuuugugcggauacgggg
miRNA Species	Homo sapiens
Regulation Mechanism	miR-3188 directly targets mTOR.		[36]
Evidence Score (E-score)	1		+
1	Immunohistochemistry; Luciferase Reporter Assay; Western Blot		[36]
Representative Target(s) Regulated by This miRNA	Serine/threonine-protein kinase mTOR (mTOR)	Target Info	MTOR_HUMAN
References
REF 1	Long noncoding RNA ANRIL indicates a poor prognosis of gastric cancer and promotes tumor growth by epigenetically silencing of miR-99a/miR-449a. Oncotarget. 2014 Apr 30;5(8):2276-92.
REF 2	miR-99a directly targets the mTOR signalling pathway in breast cancer side population cells. Cell Prolif. 2014 Dec;47(6):587-95.
REF 3	PLGA-based dual targeted nanoparticles enhance miRNA transfection efficiency in hepatic carcinoma. Sci Rep. 2017 Apr 7;7:46250.
REF 4	A dual PI3K/AKT/mTOR signaling inhibitor miR-99a suppresses endometrial carcinoma. Am J Transl Res. 2016 Feb 15;8(2):719-31.
REF 5	MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells. PLoS One. 2013 Dec 3;8(12):e80625.
REF 6	miR-99a and -99b inhibit cervical cancer cell proliferation and invasion by targeting mTOR signaling pathway. Med Oncol. 2014 May;31(5):934.
REF 7	MiR-99a antitumor activity in human breast cancer cells through targeting of mTOR expression. PLoS One. 2014 Mar 17;9(3):e92099.
REF 8	MicroRNA-100/99a, deregulated in acute lymphoblastic leukaemia, suppress proliferation and promote apoptosis by regulating the FKBP51 and IGF1R/mTOR signalling pathways. Br J Cancer. 2013 Oct 15;109(8):2189-98.
REF 9	Clinic significance of microRNA-99a expression in human lung adenocarcinoma. J Surg Oncol. 2013 Sep;108(4):248-55.
REF 10	MicroRNA-99a/100 promotes apoptosis by targeting mTOR in human esophageal squamous cell carcinoma. Med Oncol. 2013 Mar;30(1):411.
REF 11	MicroRNA-99a induces G1-phase cell cycle arrest and suppresses tumorigenicity in renal cell carcinoma. BMC Cancer. 2012 Nov 23;12:546.
REF 12	Downregulation of microRNA 99a in oral squamous cell carcinomas contributes to the growth and survival of oral cancer cells. Mol Med Rep. 2012 Sep;6(3):675-81.
REF 13	MIR-99a and MIR-99b modulate TGF- induced epithelial to mesenchymal plasticity in normal murine mammary gland cells. PLoS One. 2012;7(1):e31032.
REF 14	MicroRNA-99a inhibits hepatocellular carcinoma growth and correlates with prognosis of patients with hepatocellular carcinoma. J Biol Chem. 2011 Oct 21;286(42):36677-85.
REF 15	Regulation of insulin-like growth factor-mammalian target of rapamycin signaling by microRNA in childhood adrenocortical tumors. Cancer Res. 2010 Jun 1;70(11):4666-75.
REF 16	Insulin promotes glucose consumption via regulation of miR-99a/mTOR/PKM2 pathway. PLoS One. 2013 Jun 10;8(6):e64924.
REF 17	MicroRNA-mediated downregulation of mTOR/FGFR3 controls tumor growth induced by Src-related oncogenic pathways. Oncogene. 2011 Aug 11;30(32):3489-501.
REF 18	miRNA-100 inhibits human bladder urothelial carcinogenesis by directly targeting mTOR. Mol Cancer Ther. 2013 Feb;12(2):207-19.
REF 19	MicroRNA 100: a context dependent miRNA in prostate cancer. Clinics (Sao Paulo). 2013 Jun;68(6):797-802.
REF 20	MicroRNA 100 sensitizes luminal A breast cancer cells to paclitaxel treatment in part by targeting mTOR. Oncotarget. 2016 Feb 2;7(5):5702-14.
REF 21	MicroRNA-144-3p inhibits proliferation and induces apoptosis of human salivary adenoid carcinoma cells via targeting of mTOR. Biotechnol Lett. 2016 Mar;38(3):409-16.
REF 22	Downregulation of miR-144 is associated with colorectal cancer progression via activation of mTOR signaling pathway. Carcinogenesis. 2012 Dec;33(12):2391-7.
REF 23	MiR-144 inhibits cell proliferation of renal cell carcinoma by targeting MTOR. J Huazhong Univ Sci Technolog Med Sci. 2016 Apr;36(2):186-192.
REF 24	miRNA-99b-5p suppresses liver metastasis of colorectal cancer by down-regulating mTOR. Oncotarget. 2015 Sep 15;6(27):24448-62.
REF 25	microRNA-mediated regulation of mTOR complex components facilitates discrimination between activation and anergy in CD4 T cells. J Exp Med. 2014 Oct 20;211(11):2281-95.
REF 26	MicroRNAs as biomarkers for major depression: a role for let-7b and let-7c. Transl Psychiatry. 2016 Aug 2;6(8):e862.
REF 27	MicroRNA-193a-3p and -5p suppress the metastasis of human non-small-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene. 2015 Jan 22;34(4):413-23.
REF 28	microRNA-496 - A new, potentially aging-relevant regulator of mTOR. Cell Cycle. 2016;15(8):1108-16.
REF 29	miR-496, miR-1185, miR-654, miR-3183 and miR-495 are downregulated in colorectal cancer cells and have putative roles in the mTOR pathway. Oncol Lett. 2019 Aug;18(2):1657-1668.
REF 30	miR-125a inhibits the migration and invasion of liver cancer cells via suppression of the PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2015 Aug;10(2):681-686.
REF 31	miR-196b regulates gastric cancer cell proliferation and invasion via PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2016 Mar;11(3):1745-1749.
REF 32	MicroRNA-224 aggrevates tumor growth and progression by targeting mTOR in gastric cancer. Int J Oncol. 2016 Sep;49(3):1068-80.
REF 33	miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-B factor in human fibrosarcoma cells. J Cell Physiol. 2012 Feb;227(2):867-76.
REF 34	MiR-497 decreases cisplatin resistance in ovarian cancer cells by targeting mTOR/P70S6K1. Oncotarget. 2015 Sep 22;6(28):26457-71.
REF 35	MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res. 2010 Jun 15;70(12):5184-93.
REF 36	miR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3K/AKT-c-JUN. Nat Commun. 2016 Apr 20;7:11309.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.

Prof. Feng ZHU

Prof. Yuzong CHEN