Target Regulator(s) Information (MicroRNA)
Target General Information | |||||
---|---|---|---|---|---|
Target ID | T85943 | Target Info | |||
Target Name | Proto-oncogene c-Src (SRC) | ||||
Synonyms | pp60c-src; Tyrosine kinase (pp60(src)); Src tyrosine kinase; SRC1; Proto-oncogene tyrosine-protein kinase Src; Pp60(src); P60-Src; C-src TK; C-Src | ||||
Target Type | Successful Target | ||||
Gene Name | SRC | ||||
Biochemical Class | Kinase | ||||
UniProt ID | |||||
The microRNAs (miRNAs) Regulating This Target | |||||
miRNA Mature ID | hsa-miR-34a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggcagugucuuagcugguugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-34a Inhibits A-Src-induced Migration and Invasion. | [1] | |||
Evidence Score (E-score) | 3 | + | |||
1 | Immunoblot; Immunoprecipitation; Luciferase Reporter Assay | [1] | |||
2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [2] | |||
3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [3] | |||
Representative Target(s) Regulated by This miRNA | Amphiregulin (AREG) | Target Info | |||
Androgen receptor (AR) | Target Info | ||||
miRNA Mature ID | hsa-miR-203a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | gugaaauguuuaggaccacuag | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Src were downregulated by the overexpression of miR-203. | [4] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Immunoprecipitation; Western Blot | [4] | |||
2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [3] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
Apoptosis regulator Bcl-W (BCL-W) | Target Info | ||||
miRNA Mature ID | hsa-miR-23b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aucacauugccagggauuaccac | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Src kinase is a direct target of miR-23b in prostate cancer. | [5] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [5] | |||
2 | Luciferase Reporter Assay; RT-PCR | [6] | |||
Representative Target(s) Regulated by This miRNA | Activin receptor type IIB (ACVR2B) | Target Info | |||
Carbonic anhydrase II (CA-II) | Target Info | ||||
miRNA Mature ID | hsa-miR-31-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aggcaagaugcuggcauagcu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-31 targets melanoma oncogenes SRC. | [7] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Immunoblot; Immunohistochemistry; Luciferase Reporter Assay | [7] | |||
2 | qRT-PCR; Western Blot; Luciferase Reporter Assay | [8] | |||
Representative Target(s) Regulated by This miRNA | Cyclin-dependent kinase 1 (CDK1) | Target Info | |||
Dickkopf-related protein 1 (DKK1) | Target Info | ||||
miRNA Mature ID | hsa-miR-205-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uccuucauuccaccggagucug | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Reporter Assay | [9] | |||
Representative Target(s) Regulated by This miRNA | Androgen receptor (AR) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-33a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | gugcauuguaguugcauugca | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-33a specifically targets the 3'UTR of human Src3. | [10] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [10] | |||
Representative Target(s) Regulated by This miRNA | ATP-binding cassette transporter A1 (ABCA1) | Target Info | |||
ATP-binding cassette transporter B11 (ABCB11) | Target Info | ||||
miRNA Mature ID | hsa-miR-33b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | gugcauugcuguugcauugc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-33b binds to the 3'UTR of SRC. miR-33b significantly repressed SRC 3'UTR activities. | [11] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [11] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
ATP-binding cassette transporter A1 (ABCA1) | Target Info | ||||
References | |||||
REF 1 | CD24 induces expression of the oncomir miR-21 via Src, and CD24 and Src are both post-transcriptionally downregulated by the tumor suppressor miR-34a. PLoS One. 2013;8(3):e59563. | ||||
REF 2 | miR-34a Silences c-SRC to Attenuate Tumor Growth in Triple-Negative Breast Cancer. Cancer Res. 2016 Feb 15;76(4):927-39. | ||||
REF 3 | Posttranscriptional deregulation of Src due to aberrant miR34a and miR203 contributes to gastric cancer development. BMB Rep. 2013 Jun;46(6):316-21. | ||||
REF 4 | ING1b-inducible microRNA203 inhibits cell proliferation. Br J Cancer. 2013 Mar 19;108(5):1143-8. | ||||
REF 5 | miR-23b represses proto-oncogene Src kinase and functions as methylation-silenced tumor suppressor with diagnostic and prognostic significance in prostate cancer. Cancer Res. 2012 Dec 15;72(24):6435-46. | ||||
REF 6 | Inhibition of Src by microRNA-23b increases the cisplatin sensitivity of chondrosarcoma cells. Cancer Biomark. 2017;18(3):231-239. | ||||
REF 7 | Genetic and epigenetic loss of microRNA-31 leads to feed-forward expression of EZH2 in melanoma. Oncotarget. 2012 Sep;3(9):1011-25. | ||||
REF 8 | MiR-31 regulates the cisplatin resistance by targeting Src in gallbladder cancer. Oncotarget. 2016 Dec 13;7(50):83060-83070. | ||||
REF 9 | MicroRNA-205 inhibits Src-mediated oncogenic pathways in renal cancer. Cancer Res. 2011 Apr 1;71(7):2611-21. | ||||
REF 10 | A regulatory role for microRNA 33* in controlling lipid metabolism gene expression. Mol Cell Biol. 2013 Jun;33(11):2339-52. | ||||
REF 11 | MicroRNA 33 regulates glucose metabolism. Mol Cell Biol. 2013 Aug;33(15):2891-902. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.