Target General Information
Target ID T85943 Target Info
Target Name Proto-oncogene c-Src (SRC)
Synonyms pp60c-src; Tyrosine kinase (pp60(src)); Src tyrosine kinase; SRC1; Proto-oncogene tyrosine-protein kinase Src; Pp60(src); P60-Src; C-src TK; C-Src
Target Type Successful Target
Gene Name SRC
Biochemical Class Kinase
UniProt ID
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a Inhibits A-Src-induced Migration and Invasion. [1]
Evidence Score (E-score) 3 +
1 Immunoblot; Immunoprecipitation; Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
Androgen receptor (AR) Target Info
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism Src were downregulated by the overexpression of miR-203. [4]
Evidence Score (E-score) 2 +
1 Immunoprecipitation; Western Blot [4]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
Apoptosis regulator Bcl-W (BCL-W) Target Info
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Regulation Mechanism Src kinase is a direct target of miR-23b in prostate cancer. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay; RT-PCR [6]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
Carbonic anhydrase II (CA-II) Target Info
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-31 targets melanoma oncogenes SRC. [7]
Evidence Score (E-score) 2 +
1 Immunoblot; Immunohistochemistry; Luciferase Reporter Assay [7]
2 qRT-PCR; Western Blot; Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
Dickkopf-related protein 1 (DKK1) Target Info
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Regulation Mechanism miR-33a specifically targets the 3'UTR of human Src3. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ATP-binding cassette transporter B11 (ABCB11) Target Info
miRNA Mature ID hsa-miR-33b-5p miRNA Info
miRNA Mature AC
Sequence gugcauugcuguugcauugc
miRNA Species Homo sapiens
Regulation Mechanism miR-33b binds to the 3'UTR of SRC. miR-33b significantly repressed SRC 3'UTR activities. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
ATP-binding cassette transporter A1 (ABCA1) Target Info
References
REF 1 CD24 induces expression of the oncomir miR-21 via Src, and CD24 and Src are both post-transcriptionally downregulated by the tumor suppressor miR-34a. PLoS One. 2013;8(3):e59563.
REF 2 miR-34a Silences c-SRC to Attenuate Tumor Growth in Triple-Negative Breast Cancer. Cancer Res. 2016 Feb 15;76(4):927-39.
REF 3 Posttranscriptional deregulation of Src due to aberrant miR34a and miR203 contributes to gastric cancer development. BMB Rep. 2013 Jun;46(6):316-21.
REF 4 ING1b-inducible microRNA203 inhibits cell proliferation. Br J Cancer. 2013 Mar 19;108(5):1143-8.
REF 5 miR-23b represses proto-oncogene Src kinase and functions as methylation-silenced tumor suppressor with diagnostic and prognostic significance in prostate cancer. Cancer Res. 2012 Dec 15;72(24):6435-46.
REF 6 Inhibition of Src by microRNA-23b increases the cisplatin sensitivity of chondrosarcoma cells. Cancer Biomark. 2017;18(3):231-239.
REF 7 Genetic and epigenetic loss of microRNA-31 leads to feed-forward expression of EZH2 in melanoma. Oncotarget. 2012 Sep;3(9):1011-25.
REF 8 MiR-31 regulates the cisplatin resistance by targeting Src in gallbladder cancer. Oncotarget. 2016 Dec 13;7(50):83060-83070.
REF 9 MicroRNA-205 inhibits Src-mediated oncogenic pathways in renal cancer. Cancer Res. 2011 Apr 1;71(7):2611-21.
REF 10 A regulatory role for microRNA 33* in controlling lipid metabolism gene expression. Mol Cell Biol. 2013 Jun;33(11):2339-52.
REF 11 MicroRNA 33 regulates glucose metabolism. Mol Cell Biol. 2013 Aug;33(15):2891-902.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.