Target Regulator(s) Information (MicroRNA)
Target General Information | |||||
---|---|---|---|---|---|
Target ID | T89534 | Target Info | |||
Target Name | Estrogen receptor (ESR) | ||||
Synonyms | Nuclear receptor subfamily 3 group A member 1; NR3A1; Estradiol receptor; ESR; ER-alpha; ER | ||||
Target Type | Successful Target | ||||
Gene Name | ESR1 | ||||
Biochemical Class | Nuclear hormone receptor | ||||
UniProt ID | |||||
The microRNAs (miRNAs) Regulating This Target | |||||
miRNA Mature ID | hsa-miR-18a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaaggugcaucuagugcagauag | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-18a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target ESR1. | [2] | |||
Evidence Score (E-score) | 5 | + | |||
1 | In Situ Hybridization; Next Generation Sequencing; qRT-PCR | [1] | |||
2 | In Situ Hybridization; Next Generation Sequencing; qRT-PCR | [2] | |||
3 | Luciferase Reporter Assay; Microarray | [3] | |||
4 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [4] | |||
5 | Western Blot; qRT-PCR; Luciferase Reporter Assay | [5] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis mediating surface antigen FAS (FAS) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-206 | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggaauguaaggaagugugugg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-206 by mature miRNA precursor transfection resulted in the decreased protein level of target ESR1; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the changed mRNA level of target ESR1. | [2] | |||
Evidence Score (E-score) | 4 | + | |||
1 | Immunoblot; Luciferase Reporter Assay; qRT-PCR | [6] | |||
2 | Immunoblot; Luciferase Reporter Assay; qRT-PCR | [2] | |||
3 | Luciferase Reporter Assay; Microarray | [3] | |||
4 | qRT-PCR; Luciferase Reporter Assay | [7] | |||
Representative Target(s) Regulated by This miRNA | Annexin A2 (ANXA2) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-22-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aagcugccaguugaagaacugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-22-3p resulted in the decreased protein level of target ESR1. | [2] | |||
Evidence Score (E-score) | 4 | + | |||
1 | Luciferase Reporter Assay; Immunoblot; qRT-PCR | [6] | |||
2 | Luciferase Reporter Assay; Immunoblot; qRT-PCR | [2] | |||
3 | Western Blot | [8] | |||
4 | Western Blot | [9] | |||
Representative Target(s) Regulated by This miRNA | 5-HT 2C receptor (HTR2C) | Target Info | |||
ATP-citrate synthase (ACLY) | Target Info | ||||
miRNA Mature ID | hsa-miR-193b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacuggcccucaaagucccgcu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 3 | + | |||
1 | Luciferase Reporter Assay; Microarray | [3] | |||
2 | Luciferase Reporter Assay; Microarray | [2] | |||
3 | Western Blot | [9] | |||
Representative Target(s) Regulated by This miRNA | DNA repair protein RAD51 homolog 1 (RAD51) | Target Info | |||
Estrogen receptor (ESR) | Target Info | ||||
miRNA Mature ID | hsa-miR-221-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agcuacauugucugcuggguuuc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-221-3p resulted in the decreased protein level of target ESR1. | [2] | |||
Evidence Score (E-score) | 3 | + | |||
1 | Luciferase Reporter Assay | [10] | |||
2 | Luciferase Reporter Assay | [2] | |||
3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [11] | |||
Representative Target(s) Regulated by This miRNA | Bcl-2-binding component 3 (BBC3) | Target Info | |||
Beclin-1 (BECN1) | Target Info | ||||
miRNA Mature ID | hsa-miR-222-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agcuacaucuggcuacugggu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-222-3p resulted in the decreased protein level of target ESR1. | [2] | |||
Evidence Score (E-score) | 3 | + | |||
1 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [12] | |||
2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [11] | |||
3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [2] | |||
Representative Target(s) Regulated by This miRNA | AN1-type zinc finger protein 5 (ZFAND5) | Target Info | |||
ATP-binding cassette transporter G2 (ABCG2) | Target Info | ||||
miRNA Mature ID | hsa-miR-130a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cagugcaauguuaaaagggcau | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | GFP Reporter Assay | [13] | |||
2 | Western Blot | [9] | |||
Representative Target(s) Regulated by This miRNA | Activin receptor-like kinase 2 (ALK-2) | Target Info | |||
Amyloid beta A4 protein (APP) | Target Info | ||||
miRNA Mature ID | hsa-miR-145-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | guccaguuuucccaggaaucccu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-145 directly targets the coding sequence of estrogen receptor 1. | [14] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [14] | |||
2 | Western Blot | [9] | |||
Representative Target(s) Regulated by This miRNA | A proliferation-inducing ligand (APRIL) | Target Info | |||
Alkaline phosphatase (ALPPL2) | Target Info | ||||
miRNA Mature ID | hsa-miR-18b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaaggugcaucuagugcaguuag | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Estrogen receptor-1 is a direct target for miR-18b. | [3] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [3] | |||
2 | Western Blot | [9] | |||
Representative Target(s) Regulated by This miRNA | Connective tissue growth factor (CTGF) | Target Info | |||
Estrogen receptor (ESR) | Target Info | ||||
miRNA Mature ID | hsa-miR-19a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugugcaaaucuaugcaaaacuga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The overexpression of miR-19a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target ESR1. | [2] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [4] | |||
2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [2] | |||
Representative Target(s) Regulated by This miRNA | Adrenergic receptor beta-1 (ADRB1) | Target Info | |||
Apoptosis signal-regulating kinase 1 (MAP3K5) | Target Info | ||||
miRNA Mature ID | hsa-miR-20b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | caaagugcucauagugcagguag | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The downregulation of miR-20b-5p by Anti-miRNA Oligonucleotide resulted in the increased reporter activity of target ESR1. | [2] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Western Blot; qRT-PCR | [2] | |||
2 | Western Blot; qRT-PCR; Luciferase Reporter Assay | [5] | |||
Representative Target(s) Regulated by This miRNA | Cyclin-dependent kinase 2 (CDK2) | Target Info | |||
Cyclin-dependent kinase 6 (CDK6) | Target Info | ||||
miRNA Mature ID | hsa-miR-302c-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaagugcuuccauguuucagugg | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Microarray | [3] | |||
2 | Luciferase Reporter Assay; Microarray | [2] | |||
Representative Target(s) Regulated by This miRNA | Bone morphogenetic protein receptor (BMPR2) | Target Info | |||
Estrogen receptor (ESR) | Target Info | ||||
miRNA Mature ID | hsa-miR-19b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugugcaaauccaugcaaaacuga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The downregulation of miR-19b-3p by Anti-miRNA Oligonucleotide resulted in the increased reporter activity of target ESR1. | [2] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [2] | |||
2 | Western Blot | [9] | |||
Representative Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Target Info | |||
miRNA Mature ID | hsa-miR-26b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ccuguucuccauuacuuggcu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-26b-3p regulates the expression of ESR1 via directly binding to the CDS region of ESR1 mRNA. | [15] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [15] | |||
2 | Western Blot | [9] | |||
Representative Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Target Info | |||
miRNA Mature ID | hsa-miR-100-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacccguagauccgaacuugug | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | qRT-PCR | [16] | |||
Representative Target(s) Regulated by This miRNA | ATM serine/threonine kinase (ATM) | Target Info | |||
Bone morphogenetic protein receptor (BMPR2) | Target Info | ||||
miRNA Mature ID | hsa-miR-192-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cugaccuaugaauugacagcc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-192-5p directly binds ER-alpha 3'UTR and regulates its expression. | [17] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [17] | |||
Representative Target(s) Regulated by This miRNA | Activated leukocyte cell adhesionmolecule (ALCAM) | Target Info | |||
Activin receptor type IIB (ACVR2B) | Target Info | ||||
miRNA Mature ID | hsa-miR-181a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacauucaacgcugucggugagu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [2] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
CDK inhibitor 1B p27Kip1 (CDKN1B) | Target Info | ||||
miRNA Mature ID | hsa-miR-181b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacauucauugcugucggugggu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [2] | |||
Representative Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Target Info | |||
Glutamate receptor AMPA 2 (GRIA2) | Target Info | ||||
References | |||||
REF 1 | MiR-17-92 cluster promotes hepatocarcinogenesis. Carcinogenesis. 2015 Oct;36(10):1213-22. | ||||
REF 2 | The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47. | ||||
REF 3 | Protein lysate microarray analysis to identify microRNAs regulating estrogen receptor signaling in breast cancer cell lines. Oncogene. 2009 Nov 5;28(44):3926-36. | ||||
REF 4 | MYCN-regulated microRNAs repress estrogen receptor-alpha (ESR1) expression and neuronal differentiation in human neuroblastoma. Proc Natl Acad Sci U S A. 2010 Jan 26;107(4):1553-8. | ||||
REF 5 | The estrogen receptor-alpha-induced microRNA signature regulates itself and its transcriptional response. Proc Natl Acad Sci U S A. 2009 Sep 15;106(37):15732-7. | ||||
REF 6 | miR-22 inhibits estrogen signaling by directly targeting the estrogen receptor alpha mRNA. Mol Cell Biol. 2009 Jul;29(13):3783-90. | ||||
REF 7 | miR-206 Expression is down-regulated in estrogen receptor alpha-positive human breast cancer. Cancer Res. 2008 Jul 1;68(13):5004-8. | ||||
REF 8 | Michael T. McManus: Interrupting biology [interview by Hema Bashyam]. J Exp Med. 2008 Mar 17;205(3):506-7. | ||||
REF 9 | microRNA Regulation in Estrogen Receptor-Positive Breast Cancer and Endocrine Therapy. Biol Proced Online. 2018 Sep 11;20:17. | ||||
REF 10 | Interactions of Melanoma Cells with Distal Keratinocytes Trigger Metastasis via Notch Signaling Inhibition of MITF. Mol Cell. 2015 Aug 20;59(4):664-76. | ||||
REF 11 | MicroRNA-221/222 negatively regulates estrogen receptor alpha and is associated with tamoxifen resistance in breast cancer. J Biol Chem. 2008 Nov 7;283(45):31079-86. | ||||
REF 12 | Elevated MiR-222-3p promotes proliferation and invasion of endometrial carcinoma via targeting ER. PLoS One. 2014 Jan 31;9(1):e87563. | ||||
REF 13 | The hepatitis B virus-associated estrogen receptor alpha (ERalpha) was regulated by microRNA-130a in HepG2.2.15 human hepatocellular carcinoma cells. Acta Biochim Biophys Sin (Shanghai). 2011 Aug;43(8):640-6. | ||||
REF 14 | miR-145 participates with TP53 in a death-promoting regulatory loop and targets estrogen receptor-alpha in human breast cancer cells. Cell Death Differ. 2010 Feb;17(2):246-54. | ||||
REF 15 | miR-26b-3p Regulates Human Umbilical Cord-Derived Mesenchymal Stem Cell Proliferation by Targeting Estrogen Receptor. Stem Cells Dev. 2016 Mar 1;25(5):415-26. | ||||
REF 16 | Significance of microRNA targeted estrogen receptor in male fertility. Iran J Basic Med Sci. 2014 Feb;17(2):81-6. | ||||
REF 17 | miRNAs involved in LY6K and estrogen receptor contribute to tamoxifen-susceptibility in breast cancer. Oncotarget. 2016 Jul 5;7(27):42261-42273. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.