Target General Information
Target ID T89534 Target Info
Target Name Estrogen receptor (ESR)
Synonyms Nuclear receptor subfamily 3 group A member 1; NR3A1; Estradiol receptor; ESR; ER-alpha; ER
Target Type Successful Target
Gene Name ESR1
Biochemical Class Nuclear hormone receptor
UniProt ID
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-18a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target ESR1. [2]
Evidence Score (E-score) 5 +
1 In Situ Hybridization; Next Generation Sequencing; qRT-PCR [1]
2 In Situ Hybridization; Next Generation Sequencing; qRT-PCR [2]
3 Luciferase Reporter Assay; Microarray [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Western Blot; qRT-PCR; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-206 by mature miRNA precursor transfection resulted in the decreased protein level of target ESR1; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the changed mRNA level of target ESR1. [2]
Evidence Score (E-score) 4 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [6]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [2]
3 Luciferase Reporter Assay; Microarray [3]
4 qRT-PCR; Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-22-3p resulted in the decreased protein level of target ESR1. [2]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; Immunoblot; qRT-PCR [6]
2 Luciferase Reporter Assay; Immunoblot; qRT-PCR [2]
3 Western Blot [8]
4 Western Blot [9]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
ATP-citrate synthase (ACLY) Target Info
miRNA Mature ID hsa-miR-193b-3p miRNA Info
miRNA Mature AC
Sequence aacuggcccucaaagucccgcu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Microarray [3]
2 Luciferase Reporter Assay; Microarray [2]
3 Western Blot [9]
Representative Target(s) Regulated by This miRNA DNA repair protein RAD51 homolog 1 (RAD51) Target Info
Estrogen receptor (ESR) Target Info
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-221-3p resulted in the decreased protein level of target ESR1. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [10]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
Beclin-1 (BECN1) Target Info
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-222-3p resulted in the decreased protein level of target ESR1. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [12]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ATP-binding cassette transporter G2 (ABCG2) Target Info
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 GFP Reporter Assay [13]
2 Western Blot [9]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
Amyloid beta A4 protein (APP) Target Info
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 directly targets the coding sequence of estrogen receptor 1. [14]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [14]
2 Western Blot [9]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
Alkaline phosphatase (ALPPL2) Target Info
miRNA Mature ID hsa-miR-18b-5p miRNA Info
miRNA Mature AC
Sequence uaaggugcaucuagugcaguuag
miRNA Species Homo sapiens
Regulation Mechanism Estrogen receptor-1 is a direct target for miR-18b. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Western Blot [9]
Representative Target(s) Regulated by This miRNA Connective tissue growth factor (CTGF) Target Info
Estrogen receptor (ESR) Target Info
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-19a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target ESR1. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-20b-5p by Anti-miRNA Oligonucleotide resulted in the increased reporter activity of target ESR1. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot; qRT-PCR [2]
2 Western Blot; qRT-PCR; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
Cyclin-dependent kinase 6 (CDK6) Target Info
miRNA Mature ID hsa-miR-302c-3p miRNA Info
miRNA Mature AC
Sequence uaagugcuuccauguuucagugg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray [3]
2 Luciferase Reporter Assay; Microarray [2]
Representative Target(s) Regulated by This miRNA Bone morphogenetic protein receptor (BMPR2) Target Info
Estrogen receptor (ESR) Target Info
miRNA Mature ID hsa-miR-19b-3p miRNA Info
miRNA Mature AC
Sequence ugugcaaauccaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-19b-3p by Anti-miRNA Oligonucleotide resulted in the increased reporter activity of target ESR1. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [2]
2 Western Blot [9]
Representative Target(s) Regulated by This miRNA Estrogen receptor (ESR) Target Info
miRNA Mature ID hsa-miR-26b-3p miRNA Info
miRNA Mature AC
Sequence ccuguucuccauuacuuggcu
miRNA Species Homo sapiens
Regulation Mechanism miR-26b-3p regulates the expression of ESR1 via directly binding to the CDS region of ESR1 mRNA. [15]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [15]
2 Western Blot [9]
Representative Target(s) Regulated by This miRNA Estrogen receptor (ESR) Target Info
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [16]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
Bone morphogenetic protein receptor (BMPR2) Target Info
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism miR-192-5p directly binds ER-alpha 3'UTR and regulates its expression. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
Activin receptor type IIB (ACVR2B) Target Info
miRNA Mature ID hsa-miR-181a-5p miRNA Info
miRNA Mature AC
Sequence aacauucaacgcugucggugagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
miRNA Mature ID hsa-miR-181b-5p miRNA Info
miRNA Mature AC
Sequence aacauucauugcugucggugggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Estrogen receptor (ESR) Target Info
Glutamate receptor AMPA 2 (GRIA2) Target Info
References
REF 1 MiR-17-92 cluster promotes hepatocarcinogenesis. Carcinogenesis. 2015 Oct;36(10):1213-22.
REF 2 The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 3 Protein lysate microarray analysis to identify microRNAs regulating estrogen receptor signaling in breast cancer cell lines. Oncogene. 2009 Nov 5;28(44):3926-36.
REF 4 MYCN-regulated microRNAs repress estrogen receptor-alpha (ESR1) expression and neuronal differentiation in human neuroblastoma. Proc Natl Acad Sci U S A. 2010 Jan 26;107(4):1553-8.
REF 5 The estrogen receptor-alpha-induced microRNA signature regulates itself and its transcriptional response. Proc Natl Acad Sci U S A. 2009 Sep 15;106(37):15732-7.
REF 6 miR-22 inhibits estrogen signaling by directly targeting the estrogen receptor alpha mRNA. Mol Cell Biol. 2009 Jul;29(13):3783-90.
REF 7 miR-206 Expression is down-regulated in estrogen receptor alpha-positive human breast cancer. Cancer Res. 2008 Jul 1;68(13):5004-8.
REF 8 Michael T. McManus: Interrupting biology [interview by Hema Bashyam]. J Exp Med. 2008 Mar 17;205(3):506-7.
REF 9 microRNA Regulation in Estrogen Receptor-Positive Breast Cancer and Endocrine Therapy. Biol Proced Online. 2018 Sep 11;20:17.
REF 10 Interactions of Melanoma Cells with Distal Keratinocytes Trigger Metastasis via Notch Signaling Inhibition of MITF. Mol Cell. 2015 Aug 20;59(4):664-76.
REF 11 MicroRNA-221/222 negatively regulates estrogen receptor alpha and is associated with tamoxifen resistance in breast cancer. J Biol Chem. 2008 Nov 7;283(45):31079-86.
REF 12 Elevated MiR-222-3p promotes proliferation and invasion of endometrial carcinoma via targeting ER. PLoS One. 2014 Jan 31;9(1):e87563.
REF 13 The hepatitis B virus-associated estrogen receptor alpha (ERalpha) was regulated by microRNA-130a in HepG2.2.15 human hepatocellular carcinoma cells. Acta Biochim Biophys Sin (Shanghai). 2011 Aug;43(8):640-6.
REF 14 miR-145 participates with TP53 in a death-promoting regulatory loop and targets estrogen receptor-alpha in human breast cancer cells. Cell Death Differ. 2010 Feb;17(2):246-54.
REF 15 miR-26b-3p Regulates Human Umbilical Cord-Derived Mesenchymal Stem Cell Proliferation by Targeting Estrogen Receptor. Stem Cells Dev. 2016 Mar 1;25(5):415-26.
REF 16 Significance of microRNA targeted estrogen receptor in male fertility. Iran J Basic Med Sci. 2014 Feb;17(2):81-6.
REF 17 miRNAs involved in LY6K and estrogen receptor contribute to tamoxifen-susceptibility in breast cancer. Oncotarget. 2016 Jul 5;7(27):42261-42273.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.