miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-200a-3p
miRNA Stemloop AC MI0000737
miRNA Stemloop ID hsa-mir-200a
Sequence uaacacugucugguaacgaugu
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [2]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [3]
Thyroid hormone receptor beta (THRB) Successful Target Target Info [4]
Beta-catenin (CTNNB1) Successful Target Target Info [5]
Stress-activated protein kinase 2a (p38 alpha) Clinical trial Target Target Info [6]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [7]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [8]
Enhancer of zeste homolog 2 (EZH2) Successful Target Target Info [8]
Hepatocyte growth factor (HGF) Clinical trial Target Target Info [9]
Transforming growth factor beta 2 (TGFB2) Clinical trial Target Target Info [10]
Gap junction alpha-1 protein (GJA1) Clinical trial Target Target Info [11]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [12]
High mobility group protein B1 (HMGB1) Literature-reported Target Target Info [13]
Transferrin receptor protein 1 (TFRC) Clinical trial Target Target Info [14]
Amphiregulin (AREG) Literature-reported Target Target Info [15]
DEK protein (DEK) Literature-reported Target Target Info [16]
Yes-associated protein 1 (YAP1) Literature-reported Target Target Info [17]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [18]
G1/S-specific cyclin-E2 (CCNE2) Literature-reported Target Target Info [19]
Mothers against decapentaplegic homolog 3 (SMAD3) Preclinical Target Target Info [20]
Protein(s) Regulated by This miRNA 26S proteasome non-ATPase regulatory subunit 2 Regulated Protein
PSMD2_HUMAN
[21]
C-Jun-amino-terminal kinase-interacting protein 4 Regulated Protein
JIP4_HUMAN
[22]
Engulfment and cell motility protein 2 Regulated Protein
ELMO2_HUMAN
[23]
Erbin Regulated Protein
ERBIN_HUMAN
[23]
Ganglioside-induced differentiation-associated protein 1 Regulated Protein
GDAP1_HUMAN
[24]
Gem-associated protein 2 Regulated Protein
GEMI2_HUMAN
[25]
Hepatocyte nuclear factor 3-beta Regulated Protein
FOXA2_HUMAN
[26]
Hereditary hemochromatosis protein Regulated Protein
HFE_HUMAN
[27]
Homeobox protein DLX-5 Regulated Protein
DLX5_HUMAN
[28]
Homeobox protein Hox-B5 Regulated Protein
HXB5_HUMAN
[23]
Kelch-like protein 20 Regulated Protein
KLH20_HUMAN
[23]
Krueppel-like factor 11 Regulated Protein
KLF11_HUMAN
[23]
Metastasis-associated in colon cancer protein 1 Regulated Protein
MACC1_HUMAN
[29]
Mitochondrial fission factor Regulated Protein
MFF_HUMAN
[30]
Mothers against decapentaplegic homolog 2 Regulated Protein
SMAD2_HUMAN
[20]
Motor neuron and pancreas homeobox protein 1 Regulated Protein
MNX1_HUMAN
[32]
Myosin-10 Regulated Protein
MYH10_HUMAN
[33]
Programmed cell death protein 4 Regulated Protein
PDCD4_HUMAN
[4]
Protein VAC14 homolog Regulated Protein
VAC14_HUMAN
[23]
Protocadherin-8 Regulated Protein
PCDH8_HUMAN
[21]
Ras and Rab interactor 2 Regulated Protein
RIN2_HUMAN
[23]
Ras association domain-containing protein 2 Regulated Protein
RASF2_HUMAN
[23]
Ras GTPase-activating protein-binding protein 2 Regulated Protein
G3BP2_HUMAN
[21]
Ras-related protein Rab-30 Regulated Protein
RAB30_HUMAN
[21]
Receptor-type tyrosine-protein phosphatase delta Regulated Protein
PTPRD_HUMAN
[23]
Rho GTPase-activating protein 7 Regulated Protein
RHG07_HUMAN
[27]
Septin-7 Regulated Protein
SEPT7_HUMAN
[23]
Serum response factor Regulated Protein
SRF_HUMAN
[35]
SHC-transforming protein 1 Regulated Protein
SHC1_HUMAN
[23]
Trafficking protein particle complex subunit 2B Regulated Protein
TPC2B_HUMAN
[36]
Transcription factor 7-like 1 Regulated Protein
TF7L1_HUMAN
[23]
Transcription factor A, mitochondrial Regulated Protein
TFAM_HUMAN
[37]
Transcriptional regulator ATRX Regulated Protein
ATRX_HUMAN
[27]
Ubiquitin carboxyl-terminal hydrolase BAP1 Regulated Protein
BAP1_HUMAN
[23]
Ubiquitin-associated and SH3 domain-containing protein B Regulated Protein
UBS3B_HUMAN
[38]
WD repeat-containing protein 37 Regulated Protein
WDR37_HUMAN
[23]
Wiskott-Aldrich syndrome protein family member 3 Regulated Protein
WASF3_HUMAN
[39]
Zinc finger E-box-binding homeobox 1 Regulated Protein
ZEB1_HUMAN
[18]
Zinc finger protein ZFPM2 Regulated Protein
FOG2_HUMAN
[23]
References
REF 1 XIAP BIR domain suppresses miR-200a expression and subsequently promotes EGFR protein translation and anchorage-independent growth of bladder cancer cell. J Hematol Oncol. 2017 Jan 5;10(1):6.
REF 2 microRNA-200a is an independent prognostic factor of hepatocellular carcinoma and induces cell cycle arrest by targeting CDK6. Oncol Rep. 2013 Nov;30(5):2203-10.
REF 3 MicroRNA-29a promotes apoptosis of monocytes by targeting STAT3 during sepsis. Genet Mol Res. 2015 Oct 29;14(4):13746-53.
REF 4 MicroRNA 200a inhibits erythroid differentiation by targeting PDCD4 and THRB. Br J Haematol. 2017 Jan;176(1):50-64.
REF 5 Downregulated microRNA-200a in meningiomas promotes tumor growth by reducing E-cadherin and activating the Wnt/beta-catenin signaling pathway. Mol Cell Biol. 2009 Nov;29(21):5923-40.
REF 6 miR-141 and miR-200a act on ovarian tumorigenesis by controlling oxidative stress response. Nat Med. 2011 Nov 20;17(12):1627-35.
REF 7 A systematic screen reveals MicroRNA clusters that significantly regulate four major signaling pathways. PLoS One. 2012;7(11):e48474.
REF 8 DNMT1 and EZH2 mediated methylation silences the microRNA-200b/a/429 gene and promotes tumor progression. Cancer Lett. 2015 Apr 10;359(2):198-205.
REF 9 MiRNA-200a expression is inverse correlation with hepatocyte growth factor expression in stromal fibroblasts and its high expression predicts a good prognosis in patients with non-small cell lung cancer. Oncotarget. 2016 Jul 26;7(30):48432-48442.
REF 10 Long non-coding RNA ATB promotes glioma malignancy by negatively regulating miR-200a. J Exp Clin Cancer Res. 2016 Jun 6;35(1):90.
REF 11 Identification of miR-200a as a novel suppressor of connexin 43 in breast cancer cells. Biosci Rep. 2015 Aug 17;35(5). pii: e00251.
REF 12 MiR-200a is involved in proliferation and apoptosis in the human endometrial adenocarcinoma cell line HEC-1B by targeting the tumor suppressor PTEN. Mol Biol Rep. 2014;41(4):1977-84.
REF 13 A Myc-microRNA network promotes exit from quiescence by suppressing the interferon response and cell-cycle arrest genes. Nucleic Acids Res. 2013 Feb 1;41(4):2239-54.
REF 14 miR-320 targets transferrin receptor 1 (CD71) and inhibits cell proliferation. Exp Hematol. 2009 Feb;37(2):245-55.
REF 15 ZEB1 sensitizes lung adenocarcinoma to metastasis suppression by PI3K antagonism. J Clin Invest. 2014 Jun;124(6):2696-708.
REF 16 MiR-200a Suppresses the Proliferation and Metastasis in Pancreatic Ductal Adenocarcinoma through Downregulation of DEK Gene. Transl Oncol. 2016 Feb;9(1):25-31.
REF 17 MicroRNA-200a promotes anoikis resistance and metastasis by targeting YAP1 in human breast cancer. Clin Cancer Res. 2013 Mar 15;19(6):1389-99.
REF 18 The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008 May;10(5):593-601.
REF 19 MicroRNA-200 is commonly repressed in conjunctival MALT lymphoma, and targets cyclin E2. Graefes Arch Clin Exp Ophthalmol. 2012 Apr;250(4):523-31.
REF 20 Smad3 regulates E-cadherin via miRNA-200 pathway. Oncogene. 2012 Jun 21;31(25):3051-9.
REF 21 Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45.
REF 22 MicroRNA-200a-3p suppresses tumor proliferation and induces apoptosis by targeting SPAG9 in renal cell carcinoma.Biochem Biophys Res Commun. 2016 Feb 12;470(3):620-626.
REF 23 Conserved MicroRNA miR-8/miR-200 and its target USH/FOG2 control growth by regulating PI3K.Cell. 2009 Dec 11;139(6):1096-108.
REF 24 A comprehensive analysis of microRNA expression during human keratinocyte differentiation in vitro and in vivo. J Invest Dermatol. 2011 Jan;131(1):20-9.
REF 25 The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 2008 Apr 1;22(7):894-907.
REF 26 MicroRNA-200a inhibits cell growth and metastasis by targeting Foxa2 in hepatocellular carcinoma.J Cancer. 2017 Feb 25;8(4):617-625.
REF 27 The microRNA-200 family targets multiple non-small cell lung cancer prognostic markers in H1299 cells and BEAS-2B cells.Int J Oncol. 2013 Aug;43(2):548-60.
REF 28 MicroRNA-141 and -200a are involved in bone morphogenetic protein-2-induced mouse pre-osteoblast differentiation by targeting distal-less homeobox 5.J Biol Chem. 2009 Jul 17;284(29):19272-9.
REF 29 miR-200a suppresses cell growth and migration by targeting MACC1 and predicts prognosis in hepatocellular carcinoma.Oncol Rep. 2015 Feb;33(2):713-20.
REF 30 microRNA-200a-3p enhances mitochondrial elongation by targeting mitochondrial fission factor.BMB Rep. 2017 Apr;50(4):214-219.
REF 31 Smad3 regulates E-cadherin via miRNA-200 pathway. Oncogene. 2012 Jun 21;31(25):3051-9.
REF 32 Identification of microRNAs regulating Hlxb9 gene expression during the induction of insulin-producing cells.Cell Biol Int. 2016 May;40(5):515-23.
REF 33 miR-200a-mediated suppression of non-muscle heavy chain IIb inhibits meningioma cell migration and tumor growth in vivo.Oncogene. 2015 Apr 2;34(14):1790-8.
REF 34 MicroRNA 200a inhibits erythroid differentiation by targeting PDCD4 and THRB. Br J Haematol. 2017 Jan;176(1):50-64.
REF 35 Regulation of serum response factor by miRNA-200 and miRNA-9 modulates oligodendrocyte progenitor cell differentiation.Glia. 2012 Dec;60(12):1906-14.
REF 36 MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha.Gastroenterology. 2008 Nov;135(5):1624-1635.e24.
REF 37 microRNA-200a inhibits cell proliferation by targeting mitochondrial transcription factor A in breast cancer.DNA Cell Biol. 2014 May;33(5):291-300.
REF 38 Protein tyrosine phosphatase UBASH3B is overexpressed in triple-negative breast cancer and promotes invasion and metastasis.Proc Natl Acad Sci U S A. 2013 Jul 2;110(27):11121-6.
REF 39 The miR200 family of microRNAs regulates WAVE3-dependent cancer cell invasion.J Biol Chem. 2009 Nov 27;284(48):33019-29.
REF 40 The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008 May;10(5):593-601.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.