miRNA General Information
miRNA Mature ID hsa-miR-296-5p
miRNA Stemloop AC MI0000747
miRNA Stemloop ID hsa-mir-296
Sequence agggcccccccucaauccugu
TTD Target(s) Regulated by This miRNA Fibroblast growth factor receptor 1 (FGFR1) Successful Target Target Info [1]
Vascular endothelial growth factor receptor 2 (KDR) Successful Target Target Info [2]
Multidrug resistance protein 1 (ABCB1) Successful Target Target Info [3]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [4]
Low-affinity nerve growth factor receptor (NGFR) Successful Target Target Info [5]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [2]
Polo-like kinase 1 (PLK1) Clinical trial Target Target Info [6]
Rotamase Pin1 (PIN1) Clinical trial Target Target Info [7]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [8]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [2]
Delta-like protein 4 (DLL4) Clinical trial Target Target Info [2]
S100 calcium-binding protein B (S100B) Clinical trial Target Target Info [9]
Caspase-8 (CASP8) Patented-recorded Target Target Info [5]
Bcl-2-binding component 3 (BBC3) Literature-reported Target Target Info [10]
CDK inhibitor 1B p27Kip1 (CDKN1B) Literature-reported Target Target Info [11]
ELAV-like protein 1 (ELAVL1) Literature-reported Target Target Info [12]
High mobility group protein HMG-I/Y (HMGA1) Literature-reported Target Target Info [13]
Inhibitor of nuclear factor kappa-B kinase (IKK) Patented-recorded Target Target Info [14]
Protein(s) Regulated by This miRNA Hepatocyte growth factor-regulated tyrosine kinase substrate Regulated Protein [15]
Homeobox protein CDX-1 Regulated Protein [16]
Protein scribble homolog Regulated Protein [17]
Serine/threonine-protein kinase WNK4 Regulated Protein [18]
References
REF 1 miR-296 inhibits proliferation and induces apoptosis by targeting FGFR1 in human hepatocellular carcinoma. FEBS Lett. 2016 Dec;590(23):4252-4262.
REF 2 Prongiogenic microRNA 96 upregulatesvascular endothelial growth factor and downregulates Notch1 following cerebral ischemic injury. Mol Med Rep. 2015 Dec;12(6):8141-7.
REF 3 Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9.
REF 4 miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 5 MicroRNA-296-5p Promotes Invasiveness through Downregulation of Nerve Growth Factor Receptor and Caspase-8. Mol Cells. 2017 Apr;40(4):254-261.
REF 6 miR-296-5p suppresses cell viability by directly targeting PLK1 in non-small cell lung cancer. Oncol Rep. 2016 Jan;35(1):497-503.
REF 7 MicroRNA-296-5p (miR-296-5p) functions as a tumor suppressor in prostate cancer by directly targeting Pin1. Biochim Biophys Acta. 2014 Sep;1843(9):2055-66.
REF 8 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 9 Deregulated miR-296/S100A4 axis promotes tumor invasion by inducing epithelial-mesenchymal transition in human ovarian cancer. Am J Cancer Res. 2016 Jan 15;6(2):260-9.
REF 10 A role for miR-296 in the regulation of lipoapoptosis by targeting PUMA. J Lipid Res. 2011 Aug;52(8):1517-25.
REF 11 miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1. J Biol Chem. 2007 Aug 10;282(32):23716-24.
REF 12 MicroRNA-9 inhibits hyperglycemia-induced pyroptosis in human ventricular cardiomyocytes by targeting ELAVL1. Biochem Biophys Res Commun. 2016 Mar 18;471(4):423-9.
REF 13 Epigenetic modulation of a miR-296-5p:HMGA1 axis regulates Sox2 expression and glioblastoma stem cells. Oncogene. 2016 Sep 15;35(37):4903-13.
REF 14 Epstein-Barr virus-induced miR-155 attenuates NF-kappaB signaling and stabilizes latent virus persistence. J Virol. 2008 Nov;82(21):10436-43.
REF 15 miR-296 regulates growth factor receptor overexpression in angiogenic endothelial cells.Cancer Cell. 2008 Nov 4;14(5):382-93.
REF 16 MicroRNA-296-5p increases proliferation in gastric cancer through repression of Caudal-related homeobox 1.Oncogene. 2014 Feb 6;33(6):783-93.
REF 17 miR-296 regulation of a cell polarity-cell plasticity module controls tumor progression.Oncogene. 2012 Jan 5;31(1):27-38.
REF 18 Human with-no-lysine kinase-4 3'-UTR acting as the enhancer and being targeted by miR-296.Int J Biochem Cell Biol. 2010 Sep;42(9):1536-43.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.