miRNA General Information
miRNA Mature ID hsa-miR-34a-5p
miRNA Stemloop AC MI0000268
miRNA Stemloop ID hsa-mir-34a
Sequence uggcagugucuuagcugguugu
TTD Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Successful Target Target Info [1]
Histone deacetylase 1 (HDAC1) Successful Target Target Info [2]
Platelet-derived growth factor receptor alpha (PDGFRA) Successful Target Target Info [3]
Proto-oncogene c-Src (SRC) Successful Target Target Info [4]
Tyrosine-protein kinase Kit (KIT) Successful Target Target Info [5]
Androgen receptor (AR) Successful Target Target Info [6]
Angiotensin II receptor type-1 (AGTR1) Successful Target Target Info [7]
Cyclin-dependent kinase 4 (CDK4) Successful Target Target Info [8]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [9]
Matrix metalloproteinase-7 (MMP-7) Successful Target Target Info [10]
Peroxisome proliferator-activated receptor alpha (PPARA) Successful Target Target Info [11]
PI3-kinase gamma (PIK3CG) Successful Target Target Info [12]
Platelet-derived growth factor receptor beta (PDGFRB) Successful Target Target Info [13]
Proto-oncogene c-Met (MET) Successful Target Target Info [14]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [15]
Inosine-5'-monophosphate dehydrogenase 2 (IMPDH2) Successful Target Target Info [16]
Tyrosine-protein kinase UFO (AXL) Successful Target Target Info [2]
Voltage-gated potassium channel Kv11.1 (KCNH2) Successful Target Target Info [17]
Interferon-beta (IFNB1) Successful Target Target Info [18]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [19]
ERK activator kinase 1 (MEK1) Clinical trial Target Target Info [20]
RAC-alpha serine/threonine-protein kinase (AKT1) Clinical trial Target Target Info [12]
Mixed lineage kinase 1 (MAP3K9) Clinical trial Target Target Info [21]
NAD-dependent deacetylase sirtuin-1 (SIRT1) Clinical trial Target Target Info [22]
Apoptosis inhibitor survivin (BIRC5) Clinical trial Target Target Info [23]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [24]
Growth/differentiation factor 5 (GDF-5) Clinical trial Target Target Info [25]
Nicotinamide phosphoribosyltransferase (NAMPT) Clinical trial Target Target Info [26]
Cellular inhibitor of apoptosis 2 (BIRC3) Clinical trial Target Target Info [27]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [28]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [29]
Notch-2 receptor (NOTCH2) Clinical trial Target Target Info [30]
Beta-klotho (KLB) Clinical trial Target Target Info [31]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [32]
Extracellular matrix receptor III (CD44) Clinical trial Target Target Info [33]
Melanoma-associated antigen 3 (MAGEA3) Clinical trial Target Target Info [34]
GDNF receptor alpha-3 (GFRA3) Clinical trial Target Target Info [35]
Kruppel like factor 4 (KLF4) Clinical trial Target Target Info [36]
Colony stimulating factor-1 receptor (CSF-1R) Clinical trial Target Target Info [37]
Lysine-specific demethylase 4A (KDM4A) Patented-recorded Target Target Info [38]
M-phase inducer phosphatase 1 (MPIP1) Literature-reported Target Target Info [39]
Metabotropic glutamate receptor 7 (mGluR7) Literature-reported Target Target Info [40]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [41]
Tyrosine-protein kinase ZAP-70 (ZAP-70) Patented-recorded Target Target Info [42]
Ephrin type-A receptor 5 (EPHA5) Literature-reported Target Target Info [43]
Hepatocyte nuclear factor 4-alpha (HNF4A) Literature-reported Target Target Info [44]
Lactate dehydrogenase A (LDHA) Literature-reported Target Target Info [2]
NADPH oxidase 2 (CYBB) Literature-reported Target Target Info [45]
Protein kinase D (PRKD1) Literature-reported Target Target Info [46]
Serine/threonine-protein kinase NIK (MAP3K14) Literature-reported Target Target Info [47]
CCAAT/enhancer binding protein beta (CEBPB) Literature-reported Target Target Info [48]
DNA repair protein RAD51 homolog 1 (RAD51) Clinical trial Target Target Info [49]
High mobility group protein B1 (HMGB1) Literature-reported Target Target Info [50]
Orphan nuclear receptor NURR1 (NR4A2) Literature-reported Target Target Info [51]
Proto-oncogene c-Fos (c-Fos) Literature-reported Target Target Info [52]
Voltage-gated potassium channel Kv10.1 (KCNH1) Literature-reported Target Target Info [53]
Amphiregulin (AREG) Literature-reported Target Target Info [54]
Autophagy-related protein 7 (ATG7) Literature-reported Target Target Info [55]
Beclin-1 (BECN1) Literature-reported Target Target Info [55]
CDK inhibitor 4C p18-INK4c (CDKN2C) Literature-reported Target Target Info [56]
Cyclin D (CCND3) Literature-reported Target Target Info [39]
Fos-related antigen 1 (FOSL1) Literature-reported Target Target Info [57]
Macrophage-derived chemokine (MDC) Literature-reported Target Target Info [58]
MTOR complex 2 (RICTOR) Literature-reported Target Target Info [59]
Multiple tumor suppressor 1 (CDKN2A) Literature-reported Target Target Info [56]
N-myc proto-oncogene protein (MYCN) Literature-reported Target Target Info [29]
Transcription factor SOX-2 (SOX2) Literature-reported Target Target Info [60]
CREB-regulated transcription coactivator 1 (TORC1) Clinical trial Target Target Info [61]
G1/S-specific cyclin-E2 (CCNE2) Literature-reported Target Target Info [8]
Melanoma-associated antigen 2 (MAGEA2) Literature-reported Target Target Info [34]
Small cell lung carcinoma cluster 4 antigen (CD24) Literature-reported Target Target Info [4]
Stathmin-1 (STMN1) Literature-reported Target Target Info [62]
Protein(s) Regulated by This miRNA Actin-binding LIM protein 1 Regulated Protein [54]
Activator of apoptosis harakiri Regulated Protein [64]
AH receptor-interacting protein Regulated Protein [65]
Alpha-(1,6)-fucosyltransferase Regulated Protein [66]
Ankyrin-3 Regulated Protein [67]
Apoptosis regulator BAX Regulated Protein [68]
Apoptosis-inducing factor 1, mitochondrial Regulated Protein [64]
Apoptosis-stimulating of p53 protein 2 Regulated Protein [64]
Apoptotic protease-activating factor 1 Regulated Protein [64]
Astrocytic phosphoprotein PEA-15 Regulated Protein [54]
ATP synthase subunit s, mitochondrial Regulated Protein [69]
Autophagy protein 5 Regulated Protein [55]
Axin-2 Regulated Protein [71]
B-cell lymphoma/leukemia 10 Regulated Protein [64]
Baculoviral IAP repeat-containing protein 1 Regulated Protein [64]
Baculoviral IAP repeat-containing protein 6 Regulated Protein [64]
BAG family molecular chaperone regulator 1 Regulated Protein [64]
BAG family molecular chaperone regulator 3 Regulated Protein [64]
Bcl-2-interacting killer Regulated Protein [64]
Bcl-2-like protein 11 Regulated Protein [64]
Bcl-2-related protein A1 Regulated Protein [64]
BCL2/adenovirus E1B 19 kDa protein-interacting protein 2 Regulated Protein [64]
BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 Regulated Protein [64]
Beta-1,4-galactosyltransferase 5 Regulated Protein [54]
Beta/gamma crystallin domain-containing protein 1 Regulated Protein [54]
Bifunctional apoptosis regulator Regulated Protein [64]
Bone morphogenetic protein 7 Regulated Protein [72]
Calcipressin-1 Regulated Protein [73]
Caspase-14 Regulated Protein [64]
Cell death activator CIDE-A Regulated Protein [64]
Cell death activator CIDE-B Regulated Protein [64]
Circadian locomoter output cycles protein kaput Regulated Protein [54]
Cysteine protease ATG4A Regulated Protein [55]
Cysteine protease ATG4B Regulated Protein [55]
Cysteine protease ATG4B Regulated Protein [74]
Cysteine protease ATG4C Regulated Protein [55]
Cysteine protease ATG4D Regulated Protein [55]
Cytochrome c Regulated Protein [64]
Death domain-containing protein CRADD Regulated Protein [64]
Death-associated protein kinase 1 Regulated Protein [64]
Dedicator of cytokinesis protein 3 Regulated Protein [54]
Delta-like protein 1 Regulated Protein [29]
Deoxyguanosine kinase, mitochondrial Regulated Protein [76]
E3 ubiquitin-protein ligase RNF169 Regulated Protein [54]
Epithelial membrane protein 1 Regulated Protein [27]
FERM domain-containing protein 4A Regulated Protein [47]
Flotillin-2 Regulated Protein [79]
Forkhead box protein P1 Regulated Protein [48]
Forkhead box protein P1 Regulated Protein [81]
Growth arrest and DNA damage-inducible protein GADD45 alpha Regulated Protein [64]
Growth arrest-specific protein 1 Regulated Protein [82]
Hepatocyte nuclear factor 4-gamma Regulated Protein [83]
Homeobox protein NANOG Regulated Protein [60]
Homeobox protein TGIF2 Regulated Protein [85]
Hypoxanthine-guanine phosphoribosyltransferase Regulated Protein [86]
Inhibin beta B chain Regulated Protein [87]
Inositol monophosphatase 1 Regulated Protein [16]
Insulin-like growth factor 2 mRNA-binding protein 3 Regulated Protein [89]
Interleukin-6 receptor subunit alpha Regulated Protein [90]
Krueppel-like factor 12 Regulated Protein [91]
Long-chain-fatty-acid--CoA ligase 1 Regulated Protein [2]
Lymphoid enhancer-binding factor 1 Regulated Protein [2]
Melanoma-associated antigen 12 Regulated Protein [34]
Melanoma-associated antigen 6 Regulated Protein [34]
Metastasis-associated protein MTA2 Regulated Protein [44]
Mothers against decapentaplegic homolog 4 Regulated Protein [95]
Mothers against decapentaplegic homolog 4 Regulated Protein [96]
N-acetylgalactosaminyltransferase 7 Regulated Protein [97]
NAD-dependent protein deacetylase sirtuin-6 Regulated Protein [98]
NAD-dependent protein deacetylase sirtuin-7 Regulated Protein [99]
Neural cell adhesion molecule L1 Regulated Protein [100]
Nuclear receptor coactivator 1 Regulated Protein [54]
Nucleolar protein 3 Regulated Protein [64]
Peptidyl-glycine alpha-amidating monooxygenase Regulated Protein [101]
Peptidyl-prolyl cis-trans isomerase FKBP1B Regulated Protein [102]
Period circadian protein homolog 1 Regulated Protein [47]
Poly(rC)-binding protein 2 Regulated Protein [103]
POU domain, class 5, transcription factor 1 Regulated Protein [104]
Protein jagged-1 Regulated Protein [105]
Protein Mdm4 Regulated Protein [106]
Protein NLRC5 Regulated Protein [107]
Protein numb homolog Regulated Protein [108]
Protein S100-P Regulated Protein [109]
Proto-oncogene Wnt-1 Regulated Protein [71]
Retinol-binding protein 2 Regulated Protein [110]
Rho GDP-dissociation inhibitor 2 Regulated Protein [111]
Serine/threonine-protein phosphatase 1 regulatory subunit 10 Regulated Protein [112]
Serine/threonine-protein phosphatase PP1-gamma catalytic subunit Regulated Protein [113]
Synaptotagmin-1 Regulated Protein [114]
Syntaxin-1A Regulated Protein [114]
Target of Myb protein 1 Regulated Protein [54]
TNF receptor-associated factor 2 Regulated Protein [64]
TNF receptor-associated factor 3 Regulated Protein [64]
Transcription factor 7 Regulated Protein [115]
Transcription factor PU.1 Regulated Protein [48]
Transcriptional repressor protein YY1 Regulated Protein [116]
Triggering receptor expressed on myeloid cells 2 Regulated Protein [117]
Tumor necrosis factor receptor superfamily member 21 Regulated Protein [64]
Tumor necrosis factor receptor superfamily member 6B Regulated Protein [27]
Tumor protein p73 Regulated Protein [64]
UL16-binding protein 2 Regulated Protein [118]
Vesicle-associated membrane protein 2 Regulated Protein [29]
Voltage-dependent L-type calcium channel subunit beta-3 Regulated Protein [67]
Zinc finger protein SNAI1 Regulated Protein [119]
References
REF 1 MiR-34a modulates ErbB2 in breast cancer. Cell Biol Int. 2017 Jan;41(1):93-101.
REF 2 Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
REF 3 miR-34a repression in proneural malignant gliomas upregulates expression of its target PDGFRA and promotes tumorigenesis. PLoS One. 2012;7(3):e33844.
REF 4 CD24 induces expression of the oncomir miR-21 via Src, and CD24 and Src are both post-transcriptionally downregulated by the tumor suppressor miR-34a. PLoS One. 2013;8(3):e59563.
REF 5 MiR-34a-5p promotes the multi-drug resistance of osteosarcoma by targeting the CD117 gene. Oncotarget. 2016 May 10;7(19):28420-34.
REF 6 Inactivation of AR and Notch-1 signaling by miR-34a attenuates prostate cancer aggressiveness. Am J Transl Res. 2012;4(4):432-42.
REF 7 The miR-34a-5p promotes the multi-chemoresistance of osteosarcoma via repression of the AGTR1 gene. BMC Cancer. 2017 Jan 10;17(1):45.
REF 8 microRNAs join the p53 network--another piece in the tumour-suppression puzzle. Nat Rev Cancer. 2007 Nov;7(11):819-22.
REF 9 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 10 MiRNA-34a inhibits EGFR-signaling-dependent MMP7 activation in gastric cancer. Tumour Biol. 2014 Oct;35(10):9801-6.
REF 11 Effect of miR-34a in regulating steatosis by targeting PPAR expression in nonalcoholic fatty liver disease. Sci Rep. 2015 Sep 2;5:13729.
REF 12 Upregulation of miR-34a by diallyl disulfide suppresses invasion and induces apoptosis in SGC-7901 cells through inhibition of the PI3K/Akt signali... Oncol Lett. 2016 Apr;11(4):2661-2667.
REF 13 MiR-34a/c-Dependent PDGFR-/ Downregulation Inhibits Tumorigenesis and Enhances TRAIL-Induced Apoptosis in Lung Cancer. PLoS One. 2013 Jun 21;8(6):e67581.
REF 14 Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405.
REF 15 miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 16 A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH. Biochem Biophys Res Commun. 2012 Feb 24;418(4):682-8.
REF 17 MiR-133b contributes to arsenic-induced apoptosis in U251 glioma cells by targeting the hERG channel. J Mol Neurosci. 2015 Apr;55(4):985-94.
REF 18 MicroRNA regulation of IFN-beta protein expression: rapid and sensitive modulation of the innate immune response. J Immunol. 2010 Mar 1;184(5):2369-76.
REF 19 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 20 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 21 MicroRNA-34a is a potent tumor suppressor molecule in vivo in neuroblastoma. BMC Cancer. 2011 Jan 25;11:33.
REF 22 miR-34a repression of SIRT1 regulates apoptosis. Proc Natl Acad Sci U S A. 2008 Sep 9;105(36):13421-6.
REF 23 Expression and regulatory function of miRNA-34a in targeting survivin in gastric cancer cells. Tumour Biol. 2013 Apr;34(2):963-71.
REF 24 Downregulation of miR-34a in breast tumors is not associated with either p53 mutations or promoter hypermethylation while it correlates with metastasis. Med Oncol. 2013 Mar;30(1):413.
REF 25 Inhibition of microRNA-34a prevents IL-1-induced extracellular matrix degradation in nucleus pulposus by increasing GDF5 expression. Exp Biol Med (Maywood). 2016 Nov;241(17):1924-1932.
REF 26 Elevated microRNA-34a in obesity reduces NAD+ levels and SIRT1 activity by directly targeting NAMPT. Aging Cell. 2013 Dec;12(6):1062-72.
REF 27 Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol Cell. 2007 Jun 8;26(5):745-52.
REF 28 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 29 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 30 MicroRNA-34a inhibits glioblastoma growth by targeting multiple oncogenes. Cancer Res. 2009 Oct 1;69(19):7569-76.
REF 31 Aberrantly elevated microRNA-34a in obesity attenuates hepatic responses to FGF19 by targeting a membrane coreceptor -Klotho. Proc Natl Acad Sci U S A. 2012 Oct 2;109(40):16137-42.
REF 32 Tumor-suppressive miR-34a induces senescence-like growth arrest through modulation of the E2F pathway in human colon cancer cells. Proc Natl Acad Sci U S A. 2007 Sep 25;104(39):15472-7.
REF 33 The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis. Nat Cell Biol. 2008 Feb;10(2):202-10.
REF 34 miR-34a confers chemosensitivity through modulation of MAGE-A and p53 in medulloblastoma. Neuro Oncol. 2011 Feb;13(2):165-75.
REF 35 Identification of targets of tumor suppressor microRNA-34a using a reporter library system. Proc Natl Acad Sci U S A. 2017 Apr 11;114(15):3927-3932.
REF 36 MiR-34a regulates apoptosis in liver cells by targeting the KLF4 gene. Cell Mol Biol Lett. 2014 Mar;19(1):52-64.
REF 37 MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells. Front Immunol. 2013 Oct 30;4:353.
REF 38 JMJD2A predicts prognosis and regulates cell growth in human gastric cancer. Biochem Biophys Res Commun. 2014 Jun 20;449(1):1-7.
REF 39 Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. FEBS Lett. 2008 Apr 30;582(10):1564-8.
REF 40 MicroRNAs in psychiatric and neurodevelopmental disorders. Brain Res. 2010 Jun 18;1338:78-88.
REF 41 Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79.
REF 42 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
REF 43 MicroRNA-34a regulates migration of chondroblast and IL-1-induced degeneration of chondrocytes by targeting EphA5. Biochem Biophys Res Commun. 2011 Dec 2;415(4):551-7.
REF 44 MicroRNAs regulate human hepatocyte nuclear factor 4alpha, modulating the expression of metabolic enzymes and cell cycle. J Biol Chem. 2010 Feb 12;285(7):4415-22.
REF 45 MicroRNA-34a induces apoptosis in the human glioma cell line, A172, through enhanced ROS production and NOX2 expression. Biochem Biophys Res Commun. 2014 Jan 31;444(1):6-12.
REF 46 A novel miR-34a target, protein kinase D1, stimulates cancer stemness and drug resistance through GSK3/-catenin signaling in breast cancer. Oncotarget. 2016 Mar 22;7(12):14791-802.
REF 47 Differential expression of microRNA in endothelial cells incubated with serum of hypertension patients with blood-stasis syndrome. Chin J Integr Med. 2015 Nov;21(11):817-22.
REF 48 MicroRNA-34a perturbs B lymphocyte development by repressing the forkhead box transcription factor Foxp1. Immunity. 2010 Jul 23;33(1):48-59.
REF 49 In Vivo Delivery of miR-34a Sensitizes Lung Tumors to Radiation Through RAD51 Regulation. Mol Ther Nucleic Acids. 2015 Dec 15;4:e270.
REF 50 Downregulation of HMGB1 by miR-34a is sufficient to suppress proliferation, migration and invasion of human cervical and colorectal cancer cells. Tumour Biol. 2016 Oct;37(10):13155-13166.
REF 51 Identification of microRNAs regulated by activin A in human embryonic stem cells. J Cell Biochem. 2010 Jan 1;109(1):93-102.
REF 52 Reduction of c-Fos via Overexpression of miR-34a Results in Enhancement of TNF- Production by LPS in Neutrophils from Myelodysplastic Syndrome Patients. PLoS One. 2016 Aug 11;11(8):e0158527.
REF 53 MicroRNA-34a inhibits human osteosarcoma proliferation by downregulating ether go-go 1 expression. Int J Med Sci. 2013;10(6):676-82.
REF 54 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 55 Chitosan nanoparticle-mediated delivery of miRNA-34a decreases prostate tumor growth in the bone and its expression induces non-canonical autophagy. Oncotarget. 2015 Oct 6;6(30):29161-77.
REF 56 Upregulation of p18Ink4c expression by oncogenic HPV E6 via p53-miR-34a pathway. Int J Cancer. 2011 Sep 15;129(6):1362-72.
REF 57 MicroRNA-34a inhibits migration and invasion of colon cancer cells via targeting to Fra-1. Carcinogenesis. 2012 Mar;33(3):519-28.
REF 58 TGF--miR-34a-CCL22 signaling-induced Treg cell recruitment promotes venous metastases of HBV-positive hepatocellular carcinoma. Cancer Cell. 2012 Sep 11;22(3):291-303.
REF 59 Tumor suppressive miRNA-34a suppresses cell proliferation and tumor growth of glioma stem cells by targeting Akt and Wnt signaling pathways. FEBS Open Bio. 2014 May 22;4:485-95.
REF 60 miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60.
REF 61 The transcription cofactor CRTC1 protects from aberrant hepatic lipid accumulation. Sci Rep. 2016 Nov 21;6:37280.
REF 62 The Microtubule Network and Cell Death Are Regulated by an miR-34a/Stathmin 1/III-Tubulin Axis. Mol Cancer Res. 2017 Jul;15(7):953-964.
REF 63 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 64 miR-34a: Multiple Opposing Targets and One Destiny in Hepatocellular Carcinoma.J Clin Transl Hepatol. 2016 Dec 28;4(4):300-305.
REF 65 Regulation of aryl hydrocarbon receptor interacting protein (AIP) protein expression by MiR-34a in sporadic somatotropinomas.PLoS One. 2015 Feb 6;10(2):e0117107.
REF 66 Effects of microRNAs on fucosyltransferase 8 (FUT8) expression in hepatocarcinoma cells.PLoS One. 2013 Oct 9;8(10):e76540.
REF 67 Dysregulation of miR-34a links neuronal development to genetic risk factors for bipolar disorder.Mol Psychiatry. 2015 May;20(5):573-84.
REF 68 MicroRNA 34a contributes to virus-mediated apoptosis through binding to its target gene Bax in influenza A virus infection.Biomed Pharmacother. 2016 Oct;83:1464-1470.
REF 69 MiR-34a is Involved in the Decrease of ATP Contents Induced by Resistin Through Target on ATP5S in HepG2 Cells.Biochem Genet. 2015 Dec;53(11-12):301-9.
REF 70 Chitosan nanoparticle-mediated delivery of miRNA-34a decreases prostate tumor growth in the bone and its expression induces non-canonical autophagy. Oncotarget. 2015 Oct 6;6(30):29161-77.
REF 71 New class of microRNA targets containing simultaneous 5'-UTR and 3'-UTR interaction sites.Genome Res. 2009 Jul;19(7):1175-83.
REF 72 microRNA miR-34a regulates cytodifferentiation and targets multi-signaling pathways in human dental papilla cells. PLoS One. 2012;7(11):e50090.
REF 73 MicroRNA-34a targets regulator of calcineurin 1 to modulate endothelial inflammation after fetal cardiac bypass in goat placenta.Placenta. 2017 Mar;51:49-56.
REF 74 Methylation-induced silencing of miR-34a enhances chemoresistance by directly upregulating ATG4B-induced autophagy through AMPK/mTOR pathway in prostate cancer.Oncol Rep. 2016 Jan;35(1):64-72.
REF 75 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 76 MicroRNA-34a enhances T cell activation by targeting diacylglycerol kinase .PLoS One. 2013 Oct 17;8(10):e77983.
REF 77 Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol Cell. 2007 Jun 8;26(5):745-52.
REF 78 Differential expression of microRNA in endothelial cells incubated with serum of hypertension patients with blood-stasis syndrome. Chin J Integr Med. 2015 Nov;21(11):817-22.
REF 79 Identification of FLOT2 as a novel target for microRNA-34a in melanoma.J Cancer Res Clin Oncol. 2015 Jun;141(6):993-1006.
REF 80 MicroRNA-34a perturbs B lymphocyte development by repressing the forkhead box transcription factor Foxp1. Immunity. 2010 Jul 23;33(1):48-59.
REF 81 Myc-mediated repression of microRNA-34a promotes high-grade transformation of B-cell lymphoma by dysregulation of FoxP1.Blood. 2011 Jun 9;117(23):6227-36.
REF 82 MiR-34a targets GAS1 to promote cell proliferation and inhibit apoptosis in papillary thyroid carcinoma via PI3K/Akt/Bad pathway.Biochem Biophys Res Commun. 2013 Nov 29;441(4):958-63.
REF 83 miR-34a inhibits proliferation and invasion of bladder cancer cells by targeting orphan nuclear receptor HNF4G.Dis Markers. 2015;2015:879254.
REF 84 miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60.
REF 85 MicroRNA-34a inhibits tumor invasion and metastasis in gastric cancer by targeting Tgif2. Int J Clin Exp Pathol. 2015 Aug 1;8(8):8921-8.
REF 86 p53-independent upregulation of miR-34a during oncogene-induced senescence represses MYC. Cell Death Differ. 2010 Feb;17(2):236-45.
REF 87 miR-34a targets the inhibin beta B gene, promoting granulosa cell apoptosis in the porcine ovary.Genet Mol Res. 2014 Jan 14;13(2):2504-12.
REF 88 A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH. Biochem Biophys Res Commun. 2012 Feb 24;418(4):682-8.
REF 89 IGF2BP3 functions as a potential oncogene and is a crucial target of miR-34a in gastric carcinogenesis.Mol Cancer. 2017 Apr 11;16(1):77.
REF 90 IL-6R/STAT3/miR-34a feedback loop promotes EMT-mediated colorectal cancer invasion and metastasis.J Clin Invest. 2014 Apr;124(4):1853-67.
REF 91 p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses. Mol Cell Proteomics. 2015 Oct;14(10):2609-29.
REF 92 Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
REF 93 miR-34a confers chemosensitivity through modulation of MAGE-A and p53 in medulloblastoma. Neuro Oncol. 2011 Feb;13(2):165-75.
REF 94 MicroRNAs regulate human hepatocyte nuclear factor 4alpha, modulating the expression of metabolic enzymes and cell cycle. J Biol Chem. 2010 Feb 12;285(7):4415-22.
REF 95 microRNA-34a inhibits epithelial mesenchymal transition in human cholangiocarcinoma by targeting Smad4 through transforming growth factor-beta/Smad pathway.BMC Cancer. 2015 Jun 16;15:469.
REF 96 miR-34a mediates oxaliplatin resistance of colorectal cancer cells by inhibiting macroautophagy via transforming growth factor-/Smad4 pathway.World J Gastroenterol. 2017 Mar 14;23(10):1816-1827.
REF 97 MicroRNA 4a/c function as tumor suppressors in Hep laryngeal carcinoma cells and may reduce GALNT7 expression.Mol Med Rep. 2014 Apr;9(4):1293-8.
REF 98 Oxidative stress dependent microRNA-34a activation via PI3K reduces the expression of sirtuin-1 and sirtuin-6 in epithelial cells. Sci Rep. 2016 Oct 21;6:35871.
REF 99 Sirt7 promotes gastric cancer growth and inhibits apoptosis by epigenetically inhibiting miR-34a.Sci Rep. 2015 Apr 10;5:9787.
REF 100 Role of miR-34a as a suppressor of L1CAM in endometrial carcinoma.Oncotarget. 2014 Jan 30;5(2):462-72.
REF 101 Aptamer-Dendrimer Bioconjugates for Targeted Delivery of miR-34a Expressing Plasmid and Antitumor Effects in Non-Small Cell Lung Cancer Cells. PLoS One. 2015 Sep 25;10(9):e0139136.
REF 102 Shikonin inhibits adipogenic differentiation via regulation ofir-34a-FKBP1B.Biochem Biophys Res Commun. 2015 Nov 27;467(4):941-7.
REF 103 The RNA-binding protein PCBP2 facilitates gastric carcinoma growth by targeting miR-34a.Biochem Biophys Res Commun. 2014 Jun 13;448(4):437-42.
REF 104 OCT4 as a target of miR-34a stimulates p63 but inhibits p53 to promote human cell transformation.Cell Death Dis. 2014 Jan 23;5:e1024.
REF 105 MicroRNA-34a suppresses invasion through downregulation of Notch1 and Jagged1 in cervical carcinoma and choriocarcinoma cells. Carcinogenesis. 2010 Jun;31(6):1037-44.
REF 106 MicroRNA-34a modulates MDM4 expression via a target site in the open reading frame.PLoS One. 2012;7(8):e42034.
REF 107 miR-34a and its novel target, NLRC5, are associated with HPV16 persistence.Infect Genet Evol. 2016 Oct;44:293-299.
REF 108 A miR-34a-Numb Feedforward Loop Triggered by Inflammation Regulates Asymmetric Stem Cell Division in Intestine and Colon Cancer.Cell Stem Cell. 2016 Feb 4;18(2):189-202.
REF 109 Expression of tumor suppressive microRNA-34a is associated with a reduced risk of bladder cancer recurrence.Int J Cancer. 2015 Sep 1;137(5):1158-66.
REF 110 MiR-34a Promotes Osteogenic Differentiation of Human Adipose-Derived Stem Cells via the RBP2/NOTCH1/CYCLIN D1 Coregulatory Network.Stem Cell Reports. 2016 Aug 9;7(2):236-48.
REF 111 Ectopic expression of miR-34a enhances radiosensitivity of non-small cell lung cancer cells, partly by suppressing the LyGDI signaling pathway.J Radiat Res. 2013 Jul 1;54(4):611-9.
REF 112 MicroRNA-34a regulates cardiac ageing and function.Nature. 2013 Mar 7;495(7439):107-10.
REF 113 Micro(mi) RNA-34a targets protein phosphatase (PP)1 to regulate DNA damage tolerance.Cell Cycle. 2015;14(24):3830-41.
REF 114 Neuronal differentiation by TAp73 is mediated by microRNA-34a regulation of synaptic protein targets.Proc Natl Acad Sci U S A. 2011 Dec 27;108(52):21093-8.
REF 115 MicroRNA-34a regulates WNT/TCF7 signaling and inhibits bone metastasis in Ras-activated prostate cancer. Oncotarget. 2015 Jan 1;6(1):441-57.
REF 116 Systematic proteome analysis identifies transcription factor YY1 as a direct target of miR-34a.J Proteome Res. 2011 Feb 4;10(2):479-87.
REF 117 microRNA-34a-Mediated Down-Regulation of the Microglial-Enriched Triggering Receptor and Phagocytosis-Sensor TREM2 in Age-Related Macular Degeneration.PLoS One. 2016 Mar 7;11(3):e0150211.
REF 118 Tumor suppressive microRNAs miR-34a/c control cancer cell expression of ULBP2, a stress-induced ligand of the natural killer cell receptor NKG2D.Cancer Res. 2012 Jan 15;72(2):460-71.
REF 119 miR-34 and SNAIL form a double-negative feedback loop to regulate epithelial-mesenchymal transitions.Cell Cycle. 2011 Dec 15;10(24):4256-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.