miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-409-3p | ||||
| miRNA Stemloop AC | MI0001735 | ||||
| miRNA Stemloop ID | hsa-mir-409 | ||||
| Sequence | gaauguugcucggugaaccccu | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Met (MET) | Successful Target | Target Info | [1] | |
| Interferon-gamma (IFNG) | Successful Target | Target Info | [2] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [3] | ||
| O-6-methylguanine-DNA-alkyltransferase (MGMT) | Clinical trial Target | Target Info | [4] | ||
| Angiogenin (ANG) | Literature-reported Target | Target Info | [5] | ||
| Fibrinogen (FGG) | Literature-reported Target | Target Info | [6] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Catenin delta-1 | Regulated Protein | [8] | ||
| Cohesin subunit SA-2 | Regulated Protein | [9] | |||
| ETS-related transcription factor Elf-2 | Regulated Protein | [10] | |||
| Fibrinogen alpha chain | Regulated Protein | [6] | |||
| Fibrinogen beta chain | Regulated Protein | [6] | |||
| GRB2-associated-binding protein 1 | Regulated Protein | [12] | |||
| PHD finger protein 10 | Regulated Protein | [13] | |||
| Proto-oncogene FRAT1 | Regulated Protein | [14] | |||
| Radixin | Regulated Protein | [15] | |||
| Ras suppressor protein 1 | Regulated Protein | [9] | |||
| Serine/threonine-protein kinase NLK | Regulated Protein | [16] | |||
| UDP-glucuronosyltransferase 2B17 | Regulated Protein | [17] | |||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [18] | |||
| References | |||||
| REF 1 | MicroRNA-409-3p inhibits migration and invasion of bladder cancer cells via targeting c-Met. Mol Cells. 2013 Jul;36(1):62-8. | ||||
| REF 2 | Reduced expression of MIR409-3p in primary immune thrombocytopenia. Br J Haematol. 2013 Apr;161(1):128-35. | ||||
| REF 3 | miR-409-3p suppresses breast cancer cell growth and invasion by targeting Akt1. Biochem Biophys Res Commun. 2016 Jan 8;469(2):189-95. | ||||
| REF 4 | miRNA array screening reveals cooperative MGMT-regulation between miR-181d-5p and miR-409-3p in glioblastoma. Oncotarget. 2016 May 10;7(19):28195-206. | ||||
| REF 5 | miR-409-3p inhibits HT1080 cell proliferation, vascularization and metastasis by targeting angiogenin. Cancer Lett. 2012 Oct 28;323(2):171-9. | ||||
| REF 6 | Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15. | ||||
| REF 7 | MicroRNA-130a regulates cell malignancy by targeting RECK in chronic myeloid leukemia. Am J Transl Res. 2016 Feb 15;8(2):955-67. | ||||
| REF 8 | MicroRNA-409-3p inhibits osteosarcoma cell migration and invasion by targeting catenin-1.Gene. 2016 Jun 10;584(1):83-9. | ||||
| REF 9 | Stromal fibroblast-derived miR-409 promotes epithelial-to-mesenchymal transition and prostate tumorigenesis.Oncogene. 2015 May 21;34(21):2690-9. | ||||
| REF 10 | MiR-409-3p regulates cell proliferation and tumor growth by targeting E74-like factor 2 in osteosarcoma.FEBS Open Bio. 2017 Jan 27;7(3):348-357. | ||||
| REF 11 | Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15. | ||||
| REF 12 | MicroRNA-409-3p suppresses colorectal cancer invasion and metastasis partly by targeting GAB1 expression.Int J Cancer. 2015 Nov 15;137(10):2310-22. | ||||
| REF 13 | MicroRNA-409-3p regulates cell proliferation and apoptosis by targeting PHF10 in gastric cancer.Cancer Lett. 2012 Jul 28;320(2):189-97. | ||||
| REF 14 | Epigenetic silencing of miR-490-3p promotes development of an aggressive colorectal cancer phenotype through activation of the Wnt/-catenin signaling pathway.Cancer Lett. 2016 Jun 28;376(1):178-87. | ||||
| REF 15 | MicroRNA-409 suppresses tumour cell invasion and metastasis by directly targeting radixin in gastric cancers.Oncogene. 2012 Oct 18;31(42):4509-16. | ||||
| REF 16 | Downregulation of microRNA-409-3p promotes aggressiveness and metastasis in colorectal cancer: an indication for personalized medicine.J Transl Med. 2015 Jun 18;13:195. | ||||
| REF 17 | Epigenetic regulation of steroid inactivating UDP-glucuronosyltransferases by microRNAs in prostate cancer.J Steroid Biochem Mol Biol. 2016 Jan;155(Pt A):85-93. | ||||
| REF 18 | MicroRNA-409-3p regulates cell invasion and metastasis by targeting ZEB1 in breast cancer.IUBMB Life. 2016 May;68(5):394-402. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.