miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-605-5p | ||||
| miRNA Stemloop AC | MI0003618 | ||||
| miRNA Stemloop ID | hsa-mir-605 | ||||
| Sequence | uaaaucccauggugccuucuccu | ||||
| TTD Target(s) Regulated by This miRNA | Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [1] | |
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [1] | ||
| Gankyrin (PSMD10) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Protein transport protein Sec24D | Regulated Protein | [3] | ||
| Transcription elongation factor A protein-like 1 | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | miR-605 joins p53 network to form a p53:miR-605:Mdm2 positive feedback loop in response to stress. EMBO J. 2011 Feb 2;30(3):524-32. | ||||
| REF 2 | MiR-605 represses PSMD10/Gankyrin and inhibits intrahepatic cholangiocarcinoma cell progression. FEBS Lett. 2014 Sep 17;588(18):3491-500. | ||||
| REF 3 | New class of microRNA targets containing simultaneous 5'-UTR and 3'-UTR interaction sites.Genome Res. 2009 Jul;19(7):1175-83. | ||||
| REF 4 | miR-605 joins p53 network to form a p53:miR-605:Mdm2 positive feedback loop in response to stress. EMBO J. 2011 Feb 2;30(3):524-32. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.