miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-638 | ||||
| miRNA Stemloop AC | MI0003653 | ||||
| miRNA Stemloop ID | hsa-mir-638 | ||||
| Sequence | agggaucgcgggcggguggcggccu | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [1] | |
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [2] | ||
| Phospholipase D1 (PLD1) | Patented-recorded Target | Target Info | [3] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [2] | ||
| Transcription factor SOX-2 (SOX2) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Dapper homolog 3 | Regulated Protein | [5] | ||
| Protein OSCP1 | Regulated Protein | [6] | |||
| START domain-containing protein 10 | Regulated Protein | [7] | |||
| Transcription factor Sp2 | Regulated Protein | [8] | |||
| Tumor protein p53-inducible nuclear protein 2 | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | miR-638 regulates differentiation and proliferation in leukemic cells by targeting cyclin-dependent kinase 2. J Biol Chem. 2015 Jan 16;290(3):1818-28. | ||||
| REF 2 | Characterization of dual PTEN and p53-targeting microRNAs identifies microRNA-638/Dnm2 as a two-hit oncogenic locus. Cell Rep. 2014 Aug 7;8(3):714-22. | ||||
| REF 3 | MicroRNA-638 inhibits cell proliferation by targeting phospholipase D1 in human gastric carcinoma. Protein Cell. 2015 Sep;6(9):680-688. | ||||
| REF 4 | Loss of miR-638 in vitro promotes cell invasion and a mesenchymal-like transition by influencing SOX2 expression in colorectal carcinoma cells. Mol Cancer. 2014 May 23;13:118. | ||||
| REF 5 | MiRNA-638 promotes autophagy and malignant phenotypes of cancer cells via directly suppressing DACT3.Cancer Lett. 2017 Apr 1;390:126-136. | ||||
| REF 6 | MicroRNA-638 is highly expressed in human vascular smooth muscle cells and inhibits PDGF-BB-induced cell proliferation and migration through targeting orphan nuclear receptor NOR1.Cardiovasc Res. 2013 Jul 1;99(1):185-93. | ||||
| REF 7 | Potentiation of docetaxel sensitivity by miR-638 via regulation of STARD10 pathway in human breast cancer cells.Biochem Biophys Res Commun. 2017 May 27;487(2):255-261. | ||||
| REF 8 | miR-638 suppresses cell proliferation in gastric cancer by targeting Sp2.Dig Dis Sci. 2014 Aug;59(8):1743-53. | ||||
| REF 9 | miR-638 promotes melanoma metastasis and protects melanoma cells from apoptosis and autophagy.Oncotarget. 2015 Feb 20;6(5):2966-80. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.