miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-663a | ||||
| miRNA Stemloop AC | MI0003672 | ||||
| miRNA Stemloop ID | hsa-mir-663a | ||||
| Sequence | aggcggggcgccgcgggaccgc | ||||
| TTD Target(s) Regulated by This miRNA | PI3-kinase delta (PIK3CD) | Successful Target | Target Info | [1] | |
| C-X-C chemokine receptor type 4 (CXCR4) | Successful Target | Target Info | [2] | ||
| Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [3] | ||
| Cyclin-dependent kinase 1 (CDK1) | Clinical trial Target | Target Info | [4] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [5] | ||
| Kruppel like factor 4 (KLF4) | Clinical trial Target | Target Info | [6] | ||
| Perlecan (HSPG) | Discontinued Target | Target Info | [7] | ||
| Large neutral amino acids transporter 1 (SLC7A5) | Literature-reported Target | Target Info | [6] | ||
| CCAAT/enhancer binding protein beta (CEBPB) | Literature-reported Target | Target Info | [6] | ||
| GTPase HRas (HRAS) | Literature-reported Target | Target Info | [8] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [9] | ||
| Protein(s) Regulated by This miRNA | Adenomatous polyposis coli protein | Regulated Protein | [10] | ||
| Elongation factor 1-alpha 2 | Regulated Protein | [11] | |||
| Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3 | Regulated Protein | [12] | |||
| Myosin regulatory light polypeptide 9 | Regulated Protein | [13] | |||
| Neuron navigator 2 | Regulated Protein | [6] | |||
| Protein fosB | Regulated Protein | [6] | |||
| Transcription elongation factor A protein-like 1 | Regulated Protein | [15] | |||
| Transcription factor jun-B | Regulated Protein | [16] | |||
| Transcription factor jun-D | Regulated Protein | [16] | |||
| References | |||||
| REF 1 | Primate-specific miR-663 functions as a tumor suppressor by targeting PIK3CD and predicts the prognosis of human glioblastoma. Clin Cancer Res. 2014 Apr 1;20(7):1803-13. | ||||
| REF 2 | miR-663a regulates growth of colon cancer cells, after administration of antimicrobial peptides, by targeting CXCR4-p21 pathway. BMC Cancer. 2017 Jan 7;17(1):33. | ||||
| REF 3 | MicroRNA-663 targets TGFB1 and regulates lung cancer proliferation. Asian Pac J Cancer Prev. 2011;12(11):2819-23. | ||||
| REF 4 | Tumor-suppressive mir-663 gene induces mitotic catastrophe growth arrest in human gastric cancer cells. Oncol Rep. 2010 Jul;24(1):105-12. | ||||
| REF 5 | ZNF224, Krpel like zinc finger protein, induces cell growth and apoptosis-resistance by down-regulation of p21 and p53 via miR-663a. Oncotarget. 2016 May 24;7(21):31177-90. | ||||
| REF 6 | MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cells. Am J Physiol Heart Circ Physiol. 2011 May;300(5):H1762-9. | ||||
| REF 7 | The overexpression of hypomethylated miR-663 induces chemotherapy resistance in human breast cancer cells by targeting heparin sulfate proteoglycan 2 (HSPG2). J Biol Chem. 2013 Apr 19;288(16):10973-85. | ||||
| REF 8 | The epigenetically-regulated miR-663 targets H-ras in K-562 cells. FEBS J. 2013 Oct;280(20):5109-17. | ||||
| REF 9 | TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41. | ||||
| REF 10 | Downregulation of adenomatous polyposis coli by microRNA-663 promotes odontogenic differentiation through activation of Wnt/beta-catenin signaling.Biochem Biophys Res Commun. 2014 Apr 18;446(4):894-900. | ||||
| REF 11 | Proto-oncogenic isoform A2 of eukaryotic translation elongation factor eEF1 is a target of miR-663 and miR-744.Br J Cancer. 2013 Jun 11;108(11):2304-11. | ||||
| REF 12 | Identification of a microRNA (miR-663a) induced by ER stress and its target gene PLOD3 by a combined microRNome and proteome approach.Cell Biol Toxicol. 2016 Aug;32(4):285-303. | ||||
| REF 13 | MicroRNA-663 regulates human vascular smooth muscle cell phenotypic switch and vascular neointimal formation.Circ Res. 2013 Oct 25;113(10):1117-27. | ||||
| REF 14 | MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cells. Am J Physiol Heart Circ Physiol. 2011 May;300(5):H1762-9. | ||||
| REF 15 | MiR-663, a microRNA targeting p21(WAF1/CIP1), promotes the proliferation and tumorigenesis of nasopharyngeal carcinoma.Oncogene. 2012 Oct 11;31(41):4421-33. | ||||
| REF 16 | Resveratrol decreases the levels of miR-155 by upregulating miR-663, a microRNA targeting JunB and JunD.Carcinogenesis. 2010 Sep;31(9):1561-6. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.