Target General Information
Target ID T25005 Target Info
Target Name Tyrosine-protein kinase BTK (ATK)
Synonyms Bruton's tyrosine kinase; Bruton tyrosine kinase; BPK; B-cell progenitor kinase; B cell progenitor kinase; Agammaglobulinemia tyrosine kinase; Agammaglobulinaemia tyrosine kinase; AGMX1
Target Type Successful Target
Gene Name BTK
Biochemical Class Kinase
UniProt ID
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism miR-210 decreased BTK protein level. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
Autophagy-related protein 7 (ATG7) Target Info
miRNA Mature ID hsa-miR-346 miRNA Info
miRNA Mature AC
Sequence ugucugcccgcaugccugccucu
miRNA Species Homo sapiens
Regulation Mechanism miR-346 indirectly regulated IL-18 release by indirectly inhibiting LPS-induced Brutons tyrosine kinase expression in LPS-activated RA FLS. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Northern Blot; Western Blot [3]
2 Luciferase Reporter Assay; qRT-PCR; Northern Blot; Western Blot [4]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
Interleukin-18 (IL18) Target Info
miRNA Mature ID hsa-miR-425-5p miRNA Info
miRNA Mature AC
Sequence aaugacacgaucacucccguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-425 decreased BTK protein level. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor receptor 3 (FGFR3) Target Info
G1/S-specific cyclin-D1 (CCND1) Target Info
miRNA Mature ID hsa-miR-1253 miRNA Info
miRNA Mature AC
Sequence agagaagaagaucagccugca
miRNA Species Homo sapiens
Regulation Mechanism miR-1253 decreased BTK protein level. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Tyrosine-protein kinase BTK (ATK) Target Info
miRNA Mature ID hsa-miR-4269 miRNA Info
miRNA Mature AC
Sequence gcaggcacagacagcccuggc
miRNA Species Homo sapiens
Regulation Mechanism miR-4269 decreased BTK protein level. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Tyrosine-protein kinase BTK (ATK) Target Info
miRNA Mature ID hsa-miR-4667-3p miRNA Info
miRNA Mature AC
Sequence ucccuccuucuguccccacag
miRNA Species Homo sapiens
Regulation Mechanism miR-4667 decreased BTK protein level. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Tyrosine-protein kinase BTK (ATK) Target Info
References
REF 1 Targeting BTK through microRNA in chronic lymphocytic leukemia. Blood. 2016 Dec 29;128(26):3101-3112.
REF 2 Role and regulation of microRNAs targeting BTK in acute myelogenous leukemia. Leuk Lymphoma. 2018 Jun;59(6):1461-1465.
REF 3 Bruton's tyrosine kinase is involved in miR-346-related regulation of IL-18 release by lipopolysaccharide-activated rheumatoid fibroblast-like synoviocytes. J Immunol. 2009 Apr 15;182(8):5088-97.
REF 4 A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.