The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-449a |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcaguguauuguuagcuggu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Direct interaction of miR-449 with the target gene GMMN 3'UTR was confirmed. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclin-dependent kinase 4 (CDK4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-449b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcaguguauuguuagcuggc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Direct interaction of miR-449 with the target gene GMMN 3'UTR was confirmed. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 4 (CDK4)
|
Target Info
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|