miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7b-3p | ||||
| miRNA Stemloop AC | MI0000063 | ||||
| miRNA Stemloop ID | hsa-let-7b | ||||
| Sequence | cuauacaaccuacugccuuccc | ||||
| TTD Target(s) Regulated by This miRNA | Caspase-3 (CASP3) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Fibroblast growth factor 5 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | let-7b suppresses apoptosis and autophagy of human mesenchymal stem cells transplanted into ischemia/reperfusion injured heart 7by targeting caspase-3. Stem Cell Res Ther. 2015 Aug 22;6:147. | ||||
| REF 2 | Alpaca fiber growth is mediated by microRNA let-7b via down-regulation of target gene FGF5.Genet Mol Res. 2015 Oct 29;14(4):13754-63. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.