miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7d-5p | ||||
| miRNA Stemloop AC | MI0000065 | ||||
| miRNA Stemloop ID | hsa-let-7d | ||||
| Sequence | agagguaguagguugcauaguu | ||||
| TTD Target(s) Regulated by This miRNA | Amyloid beta A4 protein (APP) | Successful Target | Target Info | [1] | |
| Thrombopoietin receptor (MPL) | Successful Target | Target Info | [2] | ||
| Interleukin-13 (IL13) | Successful Target | Target Info | [3] | ||
| TRAIL receptor 2 (TRAIL-R2) | Clinical trial Target | Target Info | [4] | ||
| Platelet-derived growth factor A (PDGFA) | Clinical trial Target | Target Info | [5] | ||
| Divalent metal transporter 1 (SLC11A2) | Literature-reported Target | Target Info | [6] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Collagen alpha-1(III) chain | Regulated Protein | [8] | ||
| Protein argonaute-1 | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | MicroRNA regulation of Alzheimer's Amyloid precursor protein expression. Neurobiol Dis. 2009 Mar;33(3):422-8. | ||||
| REF 2 | miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45. | ||||
| REF 3 | Let-7 microRNA-mediated regulation of IL-13 and allergic airway inflammation. J Allergy Clin Immunol. 2011 Nov;128(5):1077-85.e1-10. | ||||
| REF 4 | Nuclear death receptor TRAIL-R2 inhibits maturation of let-7 and promotes proliferation of pancreatic and other tumor cells. Gastroenterology. 2014 Jan;146(1):278-90. | ||||
| REF 5 | PDGF induced microRNA alterations in cancer cells. Nucleic Acids Res. 2011 May;39(10):4035-47. | ||||
| REF 6 | Regulation of divalent metal transporter 1 (DMT1) non-IRE isoform by the microRNA Let-7d in erythroid cells. Haematologica. 2010 Aug;95(8):1244-52. | ||||
| REF 7 | Let-7 prevents early cancer progression by suppressing expression of the embryonic gene HMGA2. Cell Cycle. 2007 Nov 1;6(21):2585-90. | ||||
| REF 8 | Let-7d suppresses growth, metastasis, and tumor macrophage infiltration in renal cell carcinoma by targeting COL3A1 and CCL7.Mol Cancer. 2014 Sep 6;13:206. | ||||
| REF 9 | Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.