miRNA General Information
miRNA Mature ID	hsa-miR-100-3p
miRNA Stemloop AC	MI0000102
miRNA Stemloop ID	hsa-mir-100
Sequence	caagcuuguaucuauagguaug
TTD Target(s) Regulated by This miRNA	Interleukin-8 (IL8)	Successful Target	Target Info	[1]
References
REF 1	MiR-100-3p and miR-877-3p regulate overproduction of IL-8 and IL-1 in mesangial cells activated by secretory IgA from IgA nephropathy patients. Exp Cell Res. 2016 Oct 1;347(2):312-21.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.