miRNA General Information
miRNA Mature ID	hsa-miR-106a-3p
miRNA Stemloop AC	MI0000113
miRNA Stemloop ID	hsa-mir-106a
Sequence	cugcaauguaagcacuucuuac
TTD Target(s) Regulated by This miRNA	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[1]
References
REF 1	MicroRNA-106a regulates phosphatase and tensin homologue expression and promotes the proliferation and invasion of ovarian cancer cells. Oncol Rep. 2016 Oct;36(4):2135-41.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.