miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-106b-3p | ||||
| miRNA Stemloop AC | MI0000734 | ||||
| miRNA Stemloop ID | hsa-mir-106b | ||||
| Sequence | ccgcacuguggguacuugcugc | ||||
| TTD Target(s) Regulated by This miRNA | Bone morphogenetic protein 2 (BMP2) | Clinical trial Target | Target Info | [1] | |
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | Silencing miR-106b accelerates osteogenesis of mesenchymal stem cells and rescues against glucocorticoid-induced osteoporosis by targeting BMP2. Bone. 2017 Apr;97:130-138. | ||||
| REF 2 | Resveratrol and pterostilbene epigenetically restore PTEN expression by targeting oncomiRs of the miR-17 family in prostate cancer. Oncotarget. 2015 Sep 29;6(29):27214-26. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.