miRNA General Information
miRNA Mature ID	hsa-miR-1182
miRNA Stemloop AC	MI0006275
miRNA Stemloop ID	hsa-mir-1182
Sequence	gagggucuugggagggaugugac
TTD Target(s) Regulated by This miRNA	Telomerase reverse transcriptase (TERT)	Clinical trial Target	Target Info	[1]
References
REF 1	miR-1182 attenuates gastric cancer proliferation and metastasis by targeting the open reading frame of hTERT. Cancer Lett. 2015 May 1;360(2):151-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.