miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1207-5p | ||||
| miRNA Stemloop AC | MI0006340 | ||||
| miRNA Stemloop ID | hsa-mir-1207 | ||||
| Sequence | uggcagggaggcugggagggg | ||||
| TTD Target(s) Regulated by This miRNA | Telomerase reverse transcriptase (TERT) | Clinical trial Target | Target Info | [1] | |
| Macrophage colony-stimulating factor 1 (CSF1) | Clinical trial Target | Target Info | [2] | ||
| Signal transducer and activator of transcription 6 (STAT6) | Literature-reported Target | Target Info | [3] | ||
| Stomatin-like protein 2 (STOML2) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | CD151 antigen | Regulated Protein | [5] | ||
| References | |||||
| REF 1 | miR-1207-5p and miR-1266 suppress gastric cancer growth and invasion by targeting telomerase reverse transcriptase. Cell Death Dis. 2014 Jan 30;5:e1034. | ||||
| REF 2 | miR-1207-5p suppresses lung cancer growth and metastasis by targeting CSF1. Oncotarget. 2016 May 31;7(22):32421-32. | ||||
| REF 3 | PVT1-derived miR-1207-5p promotes breast cancer cell growth by targeting STAT6. Cancer Sci. 2017 May;108(5):868-876. | ||||
| REF 4 | miRNA-1207-5p is associated with cancer progression by targeting stomatin-like protein 2 in esophageal carcinoma. Int J Oncol. 2015 May;46(5):2163-71. | ||||
| REF 5 | MicroRNAs Provide Feedback Regulation of Epithelial-Mesenchymal Transition Induced by Growth Factors.J Cell Physiol. 2016 Jan;231(1):120-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.