miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1225-3p | ||||
| miRNA Stemloop AC | MI0006311 | ||||
| miRNA Stemloop ID | hsa-mir-1225 | ||||
| Sequence | ugagccccugugccgcccccag | ||||
| TTD Target(s) Regulated by This miRNA | Immunoglobulin epsilon Fc receptor gamma (FCERG) | Successful Target | Target Info | [1] | |
| Protein-tyrosine phosphatase SHP-1 (PTPN6) | Patented-recorded Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Interferon alpha-inducible protein 6 | Regulated Protein | [1] | ||
| Metallothionein-1X | Regulated Protein | [1] | |||
| Ras-related protein Rap-2a | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | Expression of regulatory platelet microRNAs in patients with sickle cell disease. PLoS One. 2013 Apr 12;8(4):e60932. | ||||
| REF 2 | Expression of regulatory platelet microRNAs in patients with sickle cell disease. PLoS One. 2013 Apr 12;8(4):e60932. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.