miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-1225-5p | ||||
miRNA Stemloop AC | MI0006311 | ||||
miRNA Stemloop ID | hsa-mir-1225 | ||||
Sequence | guggguacggcccagugggggg | ||||
TTD Target(s) Regulated by This miRNA | Insulin receptor substrate-1 (IRS1) | Clinical trial Target | Target Info | [1] | |
References | |||||
REF 1 | MicroRNA-1225-5p inhibits proliferation and metastasis of gastric carcinoma through repressing insulin receptor substrate-1 and activation of -catenin signaling. Oncotarget. 2016 Jan 26;7(4):4647-63. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.