miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-125b-1-3p | ||||
| miRNA Stemloop AC | MI0000446 | ||||
| miRNA Stemloop ID | hsa-mir-125b-1 | ||||
| Sequence | acggguuaggcucuugggagcu | ||||
| TTD Target(s) Regulated by This miRNA | Sphingosine-1-phosphate receptor 1 (S1PR1) | Successful Target | Target Info | [1] | |
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [2] | ||
| Sphingosine-1-phosphate lyase 1 (SGPL1) | Clinical trial Target | Target Info | [3] | ||
| ERK activator kinase 7 (MAP2K7) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Bcl-2-interacting killer | Regulated Protein | [5] | ||
| Integrin alpha-9 | Regulated Protein | [6] | |||
| Mitochondrial fission process protein 1 | Regulated Protein | [5] | |||
| Osteocalcin | Regulated Protein | [7] | |||
| Secreted frizzled-related protein 3 | Regulated Protein | [7] | |||
| Tumor-associated calcium signal transducer 2 | Regulated Protein | [8] | |||
| References | |||||
| REF 1 | miR-125b-1-3p inhibits trophoblast cell invasion by targeting sphingosine-1-phosphate receptor 1 in preeclampsia. Biochem Biophys Res Commun. 2014 Oct 10;453(1):57-63. | ||||
| REF 2 | Interplay between RNA-binding protein HuR and microRNA-125b regulates p53 mRNA translation in response to genotoxic stress. RNA Biol. 2016 Nov;13(11):1152-1165. | ||||
| REF 3 | miR-125b Enhances IL-8 Production in Early-Onset Severe Preeclampsia by Targeting Sphingosine-1-Phosphate Lyase 1. PLoS One. 2016 Dec 9;11(12):e0166940. | ||||
| REF 4 | miR-125b inhibited epithelial-mesenchymal transition of triple-negative breast cancer by targeting MAP2K7. Onco Targets Ther. 2016 May 4;9:2639-48. | ||||
| REF 5 | miR-125b controls monocyte adaptation to inflammation through mitochondrial metabolism and dynamics.Blood. 2016 Dec 29;128(26):3125-3136. | ||||
| REF 6 | MicroRNA-125b suppresses the epithelial-mesenchymal transition and cell invasion by targeting ITGA9 in melanoma.Tumour Biol. 2016 May;37(5):5941-9. | ||||
| REF 7 | Global miRNA expression and correlation with mRNA levels in primary human bone cells.RNA. 2015 Aug;21(8):1433-43. | ||||
| REF 8 | Loss of miR-125b-1 contributes to head and neck cancer development by dysregulating TACSTD2 and MAPK pathway.Oncogene. 2014 Feb 6;33(6):702-12. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.