miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-126-3p
miRNA Stemloop AC MI0000471
miRNA Stemloop ID hsa-mir-126
Sequence ucguaccgugaguaauaaugcg
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-7 (MMP-7) Successful Target Target Info [1]
PI3-kinase gamma (PIK3CG) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [3]
C-X-C chemokine receptor type 4 (CXCR4) Successful Target Target Info [4]
Progesterone receptor (PGR) Successful Target Target Info [5]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [6]
Rho-associated protein kinase 1 (ROCK1) Successful Target Target Info [7]
RAC-alpha serine/threonine-protein kinase (AKT1) Successful Target Target Info [8]
Angiopoietin 1 receptor (TEK) Clinical trial Target Target Info [9]
NAD-dependent deacetylase sirtuin-1 (SIRT1) Clinical trial Target Target Info [10]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [11]
Enhancer of zeste homolog 2 (EZH2) Successful Target Target Info [12]
Tyrosine-protein kinase Mer (MERTK) Clinical trial Target Target Info [13]
Epidermal growth factor-like protein 7 (EGFL7) Clinical trial Target Target Info [14]
Stromal cell-derived factor 1 (CXCL12) Clinical trial Target Target Info [15]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [16]
Large neutral amino acids transporter 1 (SLC7A5) Literature-reported Target Target Info [17]
LDL receptor related protein-6 (LRP-6) Clinical trial Target Target Info [18]
Polo-like kinase 2 (PLK2) Patented-recorded Target Target Info [19]
Proto-oncogene c-Crk (c-Crk) Literature-reported Target Target Info [20]
Adrenomedullin (ADM) Clinical trial Target Target Info [21]
Insulin-like growth factor-binding protein 2 (IGFBP2) Literature-reported Target Target Info [13]
Vascular cell adhesion protein 1 (VCAM1) Literature-reported Target Target Info [22]
CDK inhibitor 1B p27Kip1 (CDKN1B) Literature-reported Target Target Info [23]
Insulin receptor substrate-1 (IRS1) Clinical trial Target Target Info [24]
Transcription factor SOX-2 (SOX2) Literature-reported Target Target Info [25]
G1/S-specific cyclin-E2 (CCNE2) Literature-reported Target Target Info [26]
Protein(s) Regulated by This miRNA Cell adhesion molecule 1 Regulated Protein
CADM1_HUMAN
[27]
Crk-like protein Regulated Protein
CRKL_HUMAN
[28]
Cytoplasmic phosphatidylinositol transfer protein 1 Regulated Protein
PITC1_HUMAN
[13]
Disintegrin and metalloproteinase domain-containing protein 9 Regulated Protein
ADAM9_HUMAN
[1]
Disintegrin and metalloproteinase domain-containing protein 9 Regulated Protein
ADAM9_HUMAN
[31]
Forkhead box protein O3 Regulated Protein
FOXO3_HUMAN
[3]
Homeobox protein Hox-A9 Regulated Protein
HXA9_HUMAN
[33]
NF-kappa-B inhibitor alpha Regulated Protein
IKBA_HUMAN
[34]
Phosphatidylinositol 3-kinase regulatory subunit beta Regulated Protein
P85B_HUMAN
[35]
Regulator of G-protein signaling 3 Regulated Protein
RGS3_HUMAN
[26]
Rho-related GTP-binding protein RhoU Regulated Protein
RHOU_HUMAN
[18]
Solute carrier family 45 member 3 Regulated Protein
S45A3_HUMAN
[38]
Sprouty-related, EVH1 domain-containing protein 1 Regulated Protein
SPRE1_HUMAN
[35]
Target of Myb protein 1 Regulated Protein
TOM1_HUMAN
[26]
Transcription factor 4 Regulated Protein
ITF2_HUMAN
[39]
Twinfilin-1 Regulated Protein
TWF1_HUMAN
[40]
Twinfilin-2 Regulated Protein
TWF2_HUMAN
[40]
Tyrosine-protein phosphatase non-receptor type 7 Regulated Protein
PTN7_HUMAN
[41]
References
REF 1 miR-126&126* restored expressions play a tumor suppressor role by directly regulating ADAM9 and MMP7 in melanoma. PLoS One. 2013;8(2):e56824.
REF 2 MicroRNA-126 inhibits tumor cell growth and its expression level correlates with poor survival in non-small cell lung cancer patients. PLoS One. 2012;7(8):e42978.
REF 3 Regulation of vascular smooth muscle cell turnover by endothelial cell-secreted microRNA-126: role of shear stress. Circ Res. 2013 Jun 21;113(1):40-51.
REF 4 Expression of miR-126 suppresses migration and invasion of colon cancer cells by targeting CXCR4. Mol Cell Biochem. 2013 Sep;381(1-2):233-42.
REF 5 MiR-126-3p regulates progesterone receptors and involves development and lactation of mouse mammary gland. Mol Cell Biochem. 2011 Sep;355(1-2):17-25.
REF 6 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 7 MicroRNA-126 inhibits tumor cell invasion and metastasis by downregulating ROCK1 in renal cell carcinoma. Mol Med Rep. 2016 Jun;13(6):5029-2036.
REF 8 MiR-126 inhibits vascular endothelial cell apoptosis through targeting PI3K/Akt signaling. Ann Hematol. 2016 Feb;95(3):365-74.
REF 9 The miR-126 regulates angiopoietin-1 signaling and vessel maturation by targeting p85. Biochim Biophys Acta. 2012 Oct;1823(10):1925-35.
REF 10 MicroRNA-126 inhibits osteosarcoma cells proliferation by targeting Sirt1. Tumour Biol. 2013 Dec;34(6):3871-7.
REF 11 MicroRNA-126 regulates DNA methylation in CD4+ T cells and contributes to systemic lupus erythematosus by targeting DNA methyltransferase 1. Arthritis Rheum. 2011 May;63(5):1376-86.
REF 12 MicroRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2. Biochem Biophys Res Commun. 2016 Oct 7;479(1):91-6.
REF 13 A microRNA regulon that mediates endothelial recruitment and metastasis by cancer cells. Nature. 2011 Dec 14;481(7380):190-4.
REF 14 miR-126 inhibits non-small cell lung cancer cells proliferation by targeting EGFL7. Biochem Biophys Res Commun. 2010 Jan 15;391(3):1483-9.
REF 15 miR-126 and miR-126* repress recruitment of mesenchymal stem cells and inflammatory monocytes to inhibit breast cancer metastasis. Nat Cell Biol. 2013 Mar;15(3):284-94.
REF 16 Deregulated expression of miR-106a predicts survival in human colon cancer patients. Genes Chromosomes Cancer. 2008 Sep;47(9):794-802.
REF 17 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 18 MiR-126 promotes coxsackievirus replication by mediating cross-talk of ERK1/2 and Wnt/-catenin signal pathways. Cell Mol Life Sci. 2013 Dec;70(23):4631-44.
REF 19 Distinct microRNA expression profiles in acute myeloid leukemia with common translocations. Proc Natl Acad Sci U S A. 2008 Oct 7;105(40):15535-40.
REF 20 Regulation of miRNA expression by Src and contact normalization: effects on nonanchored cell growth and migration. Oncogene. 2009 Dec 3;28(48):4272-83.
REF 21 Repression of miR-126 and upregulation of adrenomedullin in the stromal endothelium by cancer-stromal cross talks confers angiogenesis of cervical cancer. Oncogene. 2014 Jul 10;33(28):3636-47.
REF 22 MicroRNA-126 regulates endothelial expression of vascular cell adhesion molecule 1. Proc Natl Acad Sci U S A. 2008 Feb 5;105(5):1516-21.
REF 23 Healing the injured vessel wall using microRNA-facilitated gene delivery. J Clin Invest. 2014 Sep;124(9):3694-7.
REF 24 Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90.
REF 25 MicroRNA-126 inhibits SOX2 expression and contributes to gastric carcinogenesis. PLoS One. 2011 Jan 27;6(1):e16617.
REF 26 The cell growth suppressor, mir-126, targets IRS-1. Biochem Biophys Res Commun. 2008 Dec 5;377(1):136-40.
REF 27 MicroRNA-126 regulates migration and invasion of gastric cancer by targeting CADM1. Int J Clin Exp Pathol. 2015 Aug 1;8(8):8869-80.
REF 28 CRKL promotes cell proliferation in gastric cancer and is negatively regulated by miR-126.Chem Biol Interact. 2013 Nov 25;206(2):230-8.
REF 29 A microRNA regulon that mediates endothelial recruitment and metastasis by cancer cells. Nature. 2011 Dec 14;481(7380):190-4.
REF 30 miR-126&126* restored expressions play a tumor suppressor role by directly regulating ADAM9 and MMP7 in melanoma. PLoS One. 2013;8(2):e56824.
REF 31 MiR-126 acts as a tumor suppressor in pancreatic cancer cells via the regulation of ADAM9.Mol Cancer Res. 2012 Jan;10(1):3-10.
REF 32 Regulation of vascular smooth muscle cell turnover by endothelial cell-secreted microRNA-126: role of shear stress. Circ Res. 2013 Jun 21;113(1):40-51.
REF 33 MicroRNA-126 regulates HOXA9 by binding to the homeobox.Mol Cell Biol. 2008 Jul;28(14):4609-19.
REF 34 Up-regulation of microRNA-126 may contribute to pathogenesis of ulcerative colitis via regulating NF-kappaB inhibitor IB.PLoS One. 2012;7(12):e52782.
REF 35 Attribution of vascular phenotypes of the murine Egfl7 locus to the microRNA miR-126.Development. 2008 Dec;135(24):3989-93.
REF 36 The cell growth suppressor, mir-126, targets IRS-1. Biochem Biophys Res Commun. 2008 Dec 5;377(1):136-40.
REF 37 MiR-126 promotes coxsackievirus replication by mediating cross-talk of ERK1/2 and Wnt/-catenin signal pathways. Cell Mol Life Sci. 2013 Dec;70(23):4631-44.
REF 38 Ectopic expression of miR-126*, an intronic product of the vascular endothelial EGF-like 7 gene, regulates prostein translation and invasiveness of prostate cancer LNCaP cells.J Mol Med (Berl). 2008 Mar;86(3):313-22.
REF 39 miR-139 regulates the proliferation and invasion of hepatocellular carcinoma through the WNT/TCF-4 pathway.Oncol Rep. 2014 Jan;31(1):397-404.
REF 40 Attenuation of microRNA-1 derepresses the cytoskeleton regulatory protein twinfilin-1 to provoke cardiac hypertrophy.J Cell Sci. 2010 Jul 15;123(Pt 14):2444-52.
REF 41 Regulated expression of microRNAs-126/126* inhibits erythropoiesis from human embryonic stem cells.Blood. 2011 Feb 17;117(7):2157-65.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.