miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-126-5p | ||||
| miRNA Stemloop AC | MI0000471 | ||||
| miRNA Stemloop ID | hsa-mir-126 | ||||
| Sequence | cauuauuacuuuugguacgcg | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-7 (MMP-7) | Successful Target | Target Info | [1] | |
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [2] | ||
| Stromal cell-derived factor 1 (CXCL12) | Clinical trial Target | Target Info | [3] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [4] | ||
| Proto-oncogene c-Crk (c-Crk) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Disintegrin and metalloproteinase domain-containing protein 9 | Regulated Protein | [1] | ||
| Solute carrier family 45 member 3 | Regulated Protein | [7] | |||
| Sprouty-related, EVH1 domain-containing protein 1 | Regulated Protein | [8] | |||
| Tyrosine-protein phosphatase non-receptor type 7 | Regulated Protein | [9] | |||
| Ubiquitin carboxyl-terminal hydrolase CYLD | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | miR-126&126* restored expressions play a tumor suppressor role by directly regulating ADAM9 and MMP7 in melanoma. PLoS One. 2013;8(2):e56824. | ||||
| REF 2 | Down-regulation of microRNA-126-5p contributes to overexpression of VEGFA in lipopolysaccharide-induced acute lung injury. Biotechnol Lett. 2016 Aug;38(8):1277-84. | ||||
| REF 3 | miR-126 and miR-126* repress recruitment of mesenchymal stem cells and inflammatory monocytes to inhibit breast cancer metastasis. Nat Cell Biol. 2013 Mar;15(3):284-94. | ||||
| REF 4 | MMSET stimulates myeloma cell growth through microRNA-mediated modulation of c-MYC. Leukemia. 2013 Mar;27(3):686-94. | ||||
| REF 5 | Overexpression of miR-126 inhibits the activation and migration of HSCs through targeting CRK. Cell Physiol Biochem. 2014;33(1):97-106. | ||||
| REF 6 | miR-126&126* restored expressions play a tumor suppressor role by directly regulating ADAM9 and MMP7 in melanoma. PLoS One. 2013;8(2):e56824. | ||||
| REF 7 | Ectopic expression of miR-126*, an intronic product of the vascular endothelial EGF-like 7 gene, regulates prostein translation and invasiveness of prostate cancer LNCaP cells.J Mol Med (Berl). 2008 Mar;86(3):313-22. | ||||
| REF 8 | Lipoxin A4 stimulates endothelial miR-126-5p expression and its transfer via microvesicles.FASEB J. 2017 May;31(5):1856-1866. | ||||
| REF 9 | Regulated expression of microRNAs-126/126* inhibits erythropoiesis from human embryonic stem cells.Blood. 2011 Feb 17;117(7):2157-65. | ||||
| REF 10 | MicroRNA miR-126-5p Enhances the Inflammatory Responses of Monocytes to Lipopolysaccharide Stimulation by Suppressing Cylindromatosis in Chronic HIV-1 Infection.J Virol. 2017 Apr 28;91(10). pii: e02048-16. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.