miRNA General Information
miRNA Mature ID	hsa-miR-1266-5p
miRNA Stemloop AC	MI0006403
miRNA Stemloop ID	hsa-mir-1266
Sequence	ccucagggcuguagaacagggcu
TTD Target(s) Regulated by This miRNA	Telomerase reverse transcriptase (TERT)	Clinical trial Target	Target Info	[1]
References
REF 1	miR-1207-5p and miR-1266 suppress gastric cancer growth and invasion by targeting telomerase reverse transcriptase. Cell Death Dis. 2014 Jan 30;5:e1034.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.