miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-127-5p | ||||
| miRNA Stemloop AC | MI0000472 | ||||
| miRNA Stemloop ID | hsa-mir-127 | ||||
| Sequence | cugaagcucagagggcucugau | ||||
| TTD Target(s) Regulated by This miRNA | Osteopontin (SPP1) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Flavin reductase (NADPH) | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MicroRNA-127-5p regulates osteopontin expression and osteopontin-mediated proliferation of human chondrocytes. Sci Rep. 2016 Apr 29;6:25032. | ||||
| REF 2 | MicroRNA-127-5p targets the biliverdin reductase B/nuclear factor-B pathway to suppress cell growth in hepatocellular carcinoma cells.Cancer Sci. 2016 Mar;107(3):258-66. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.