miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1271-5p | ||||
| miRNA Stemloop AC | MI0003814 | ||||
| miRNA Stemloop ID | hsa-mir-1271 | ||||
| Sequence | cuuggcaccuagcaagcacuca | ||||
| TTD Target(s) Regulated by This miRNA | Glypican-3 (GPC3) | Clinical trial Target | Target Info | [1] | |
| Forkhead box protein Q1 (FOXQ1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Cyclin-G1 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | A functional screening identifies five microRNAs controlling glypican-3: role of miR-1271 down-regulation in hepatocellular carcinoma. Hepatology. 2013 Jan;57(1):195-204. | ||||
| REF 2 | MiR-1271 Inhibits Cell Proliferation, Invasion and EMT in Gastric Cancer by Targeting FOXQ1. Cell Physiol Biochem. 2015;36(4):1382-94. | ||||
| REF 3 | MiR-1271 Inhibits Ovarian Cancer Growth by Targeting Cyclin G1.Med Sci Monit. 2015 Oct 19;21:3152-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.