miRNA General Information
miRNA Mature ID	hsa-miR-128-3p
miRNA Stemloop AC	MI0000447 | MI0000727
miRNA Stemloop ID	hsa-mir-128-1 | hsa-mir-128-2
Sequence	ucacagugaaccggucucuuu
TTD Target(s) Regulated by This miRNA	NT-3 growth factor receptor (TrkC)	Successful Target	Target Info	[1]
	Adenosine A2b receptor (ADORA2B)	Successful Target	Target Info	[2]
	Polycomb complex protein BMI-1 (BMI1)	Clinical trial Target	Target Info	[3]
Protein(s) Regulated by This miRNA	Apoptosis regulator BAX	Regulated Protein	BAX_HUMAN	[4]
	ATP-dependent 6-phosphofructokinase, liver type	Regulated Protein	PFKAL_HUMAN	[5]
	Carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1	Regulated Protein	CTDS1_HUMAN	[6]
	FAS-associated death domain protein	Regulated Protein	FADD_HUMAN	[7]
	Homeobox protein NANOG	Regulated Protein	NANOG_HUMAN	[8]
	Insulin gene enhancer protein ISL-1	Regulated Protein	ISL1_HUMAN	[9]
	Mothers against decapentaplegic homolog 2	Regulated Protein	SMAD2_HUMAN	[10]
	Neuronal migration protein doublecortin	Regulated Protein	DCX_HUMAN	[11]
	Phosphatidylinositol 3-kinase regulatory subunit alpha	Regulated Protein	P85A_HUMAN	[12]
	Polycomb protein SUZ12	Regulated Protein	SUZ12_HUMAN	[13]
	POU domain, class 5, transcription factor 1	Regulated Protein	PO5F1_HUMAN	[14]
	Protein lin-28 homolog A	Regulated Protein	LN28A_HUMAN	[8]
	Reelin	Regulated Protein	RELN_HUMAN	[11]
	Sterol regulatory element-binding protein 2	Regulated Protein	SRBP2_HUMAN	[15]
	Zinc finger protein SNAI1	Regulated Protein	SNAI1_HUMAN	[16]
	Zinc finger protein SNAI2	Regulated Protein	SNAI2_HUMAN	[8]
References
REF 1	The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62.
REF 2	Adenosine 2B receptor expression is post-transcriptionally regulated by microRNA. J Biol Chem. 2010 Jun 11;285(24):18184-90.
REF 3	Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30.
REF 4	Downregulation of miRNA-128 sensitises breast cancer cell to chemodrugs by targeting Bax.Cell Biol Int. 2013 Jul;37(7):653-8.
REF 5	PFKL/miR-128 axis regulates glycolysis by inhibiting AKT phosphorylation and predicts poor survival in lung cancer. Am J Cancer Res. 2016 Jan 15;6(2):473-85.
REF 6	The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development.Genes Dev. 2007 Apr 1;21(7):744-9.
REF 7	Epigenetic regulation of microRNA-128a expression contributes to the apoptosis-resistance of human T-cell leukaemia jurkat cells by modulating expression of fas-associated protein with death domain (FADD).Biochim Biophys Acta. 2014 Mar;1843(3):590-602.
REF 8	Loss of SNAIL regulated miR-128-2 on chromosome 3p22.3 targets multiple stem cell factors to promote transformation of mammary epithelial cells.Cancer Res. 2012 Nov 15;72(22):6036-50.
REF 9	miR-128 regulates non-myocyte hyperplasia, deposition of extracellular matrix and Islet1 expression during newt cardiac regeneration.Dev Biol. 2013 Nov 15;383(2):253-63.
REF 10	miR-128 regulates differentiation of hair follicle mesenchymal stem cells into smooth muscle cells by targeting SMAD2.Acta Histochem. 2016 May;118(4):393-400.
REF 11	MiR-128 up-regulation inhibits Reelin and DCX expression and reduces neuroblastoma cell motility and invasiveness.FASEB J. 2009 Dec;23(12):4276-87.
REF 12	The Inhibition of microRNA-128 on IGF-1-Activating mTOR Signaling Involves in Temozolomide-Induced Glioma Cell Apoptotic Death.PLoS One. 2016 Nov 28;11(11):e0167096.
REF 13	MicroRNA-128 coordinately targets Polycomb Repressor Complexes in glioma stem cells.Neuro Oncol. 2013 Sep;15(9):1212-24.
REF 14	MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58.
REF 15	Pro-apoptotic miRNA-128-2 modulates ABCA1, ABCG1 and RXR expression and cholesterol homeostasis.Cell Death Dis. 2013 Aug 29;4:e780.
REF 16	The SNAIL/miR-128 axis regulated growth, invasion, metastasis, and epithelial-to-mesenchymal transition of gastric cancer.Oncotarget. 2017 Jun 13;8(24):39280-39295.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.