miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1303 | ||||
| miRNA Stemloop AC | MI0006370 | ||||
| miRNA Stemloop ID | hsa-mir-1303 | ||||
| Sequence | uuuagagacggggucuugcucu | ||||
| TTD Target(s) Regulated by This miRNA | Claudin-18 (CLDN18) | Clinical trial Target | Target Info | [1] | |
| Autophagy-related 2B (ATG2B) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | miR-1303 targets claudin-18 gene to modulate proliferation and invasion of gastric cancer cells. Dig Dis Sci. 2014 Aug;59(8):1754-63. | ||||
| REF 2 | MiR-1303 Regulates Mycobacteria Induced Autophagy by Targeting Atg2B. PLoS One. 2016 Jan 15;11(1):e0146770. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.