miRNA General Information
miRNA Mature ID	hsa-miR-130a-5p
miRNA Stemloop AC	MI0000448
miRNA Stemloop ID	hsa-mir-130a
Sequence	gcucuuuucacauugugcuacu
TTD Target(s) Regulated by This miRNA	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[1]
References
REF 1	Attenuation of cardiac dysfunction and remodeling of myocardial infarction by microRNA-130a are mediated by suppression of PTEN and activation of PI3K dependent signaling. J Mol Cell Cardiol. 2015 Dec;89(Pt A):87-97.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.