miRNA General Information
miRNA Mature ID	hsa-miR-135a-5p
miRNA Stemloop AC	MI0000452 | MI0000453
miRNA Stemloop ID	hsa-mir-135a-1 | hsa-mir-135a-2
Sequence	uauggcuuuuuauuccuauguga
TTD Target(s) Regulated by This miRNA	Janus kinase 2 (JAK-2)	Successful Target	Target Info	[1]
Protein(s) Regulated by This miRNA	Adenomatous polyposis coli protein	Regulated Protein	APC_HUMAN	[2]
	CCAAT/enhancer-binding protein delta	Regulated Protein	CEBPD_HUMAN	[3]
	Death-associated protein kinase 2	Regulated Protein	DAPK2_HUMAN	[4]
	E3 ubiquitin-protein ligase SIAH1	Regulated Protein	SIAH1_HUMAN	[5]
	Homeobox protein Hox-A10	Regulated Protein	HXA10_HUMAN	[6]
	Insulin receptor substrate 2	Regulated Protein	IRS2_HUMAN	[7]
	Krueppel-like factor 8	Regulated Protein	KLF8_HUMAN	[8]
	Metastasis suppressor protein 1	Regulated Protein	MTSS1_HUMAN	[9]
	Mothers against decapentaplegic homolog 5	Regulated Protein	SMAD5_HUMAN	[10]
	PH domain leucine-rich repeat-containing protein phosphatase 2	Regulated Protein	PHLP2_HUMAN	[11]
	Protein phosphatase 1E	Regulated Protein	PPM1E_HUMAN	[12]
	RB-associated KRAB zinc finger protein	Regulated Protein	RBAK_HUMAN	[13]
	Receptor-type tyrosine-protein phosphatase delta	Regulated Protein	PTPRD_HUMAN	[14]
	Very low-density lipoprotein receptor	Regulated Protein	VLDLR_HUMAN	[15]
References
REF 1	Regulation of JAK2 by miR-135a: prognostic impact in classic Hodgkin lymphoma. Blood. 2009 Oct 1;114(14):2945-51.
REF 2	Regulation of the adenomatous polyposis coli gene by the miR-135 family in colorectal cancer.Cancer Res. 2008 Jul 15;68(14):5795-802.
REF 3	CCAAT/enhancer-binding protein delta/miR135a/thrombospondin 1 axis mediates PGE2-induced angiogenesis in Alzheimer's disease.Neurobiol Aging. 2015 Mar;36(3):1356-68.
REF 4	miR-135a promotes gastric cancer progression and resistance to oxaliplatin.Oncotarget. 2016 Oct 25;7(43):70699-70714.
REF 5	miR-135a leads to cervical cancer cell transformation through regulation of -catenin via a SIAH1-dependent ubiquitin proteosomal pathway.Carcinogenesis. 2014 Sep;35(9):1931-40.
REF 6	miRNA-135a promotes breast cancer cell migration and invasion by targeting HOXA10.BMC Cancer. 2012 Mar 23;12:111.
REF 7	miR-135a targets IRS2 and regulates insulin signaling and glucose uptake in the diabetic gastrocnemius skeletal muscle.Biochim Biophys Acta. 2013 Aug;1832(8):1294-303.
REF 8	MiR-135a inhibits migration and invasion and regulates EMT-related marker genes by targeting KLF8 in lung cancer cells.Biochem Biophys Res Commun. 2015 Sep 11;465(1):125-30.
REF 9	MiR-135a promotes growth and invasion of colorectal cancer via metastasis suppressor 1 in vitro.Acta Biochim Biophys Sin (Shanghai). 2012 Oct;44(10):838-46.
REF 10	MiR-135a functions as a selective killer of malignant glioma.Oncogene. 2012 Aug 23;31(34):3866-74.
REF 11	Mir-135a enhances cellular proliferation through post-transcriptionally regulating PHLPP2 and FOXO1 in human bladder cancer.J Transl Med. 2015 Mar 13;13:86.
REF 12	miR-135b-5p inhibits LPS-induced TNF production via silencing AMPK phosphatase Ppm1e.Oncotarget. 2016 Nov 22;7(47):77978-77986.
REF 13	Androgen-induced miR-135a acts as a tumor suppressor through downregulating RBAK and MMP11, and mediates resistance to androgen deprivation therapy.Oncotarget. 2016 Aug 9;7(32):51284-51300.
REF 14	miR-135a-5p-mediated downregulation of protein tyrosine phosphatase receptor delta is a candidate driver of HCV-associated hepatocarcinogenesis.Gut. 2018 May;67(5):953-962.
REF 15	MicroRNA-135a acts as a putative tumor suppressor by directly targeting very low density lipoprotein receptor in human gallbladder cancer.Cancer Sci. 2014 Aug;105(8):956-65.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.