miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-135b-3p | ||||
| miRNA Stemloop AC | MI0000810 | ||||
| miRNA Stemloop ID | hsa-mir-135b | ||||
| Sequence | auguagggcuaaaagccauggg | ||||
| TTD Target(s) Regulated by This miRNA | Large tumor suppressor homolog 2 (LATS2) | Literature-reported Target | Target Info | [1] | |
| Signal transducer and activator of transcription 6 (STAT6) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | C-C motif chemokine 7 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Specific alterations of the microRNA transcriptome and global network structure in colorectal cancer after treatment with MAPK/ERK inhibitors. J Mol Med (Berl). 2012 Dec;90(12):1421-38. | ||||
| REF 2 | IL-13 mediates collagen deposition via STAT6 and microRNA-135b: a role for epigenetics. Sci Rep. 2016 Apr 26;6:25066. | ||||
| REF 3 | IL-13 mediates collagen deposition via STAT6 and microRNA-135b: a role for epigenetics. Sci Rep. 2016 Apr 26;6:25066. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.