miRNA General Information
miRNA Mature ID	hsa-miR-136-3p
miRNA Stemloop AC	MI0000475
miRNA Stemloop ID	hsa-mir-136
Sequence	caucaucgucucaaaugagucu
TTD Target(s) Regulated by This miRNA	Notch-3 receptor (NOTCH3)	Clinical trial Target	Target Info	[1]
References
REF 1	MicroRNA-136 inhibits cancer stem cell activity and enhances the anti-tumor effect of paclitaxel against chemoresistant ovarian cancer cells by targeting Notch3. Cancer Lett. 2017 Feb 1;386:168-178.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.