miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-138-1-3p | ||||
miRNA Stemloop AC | MI0000476 | ||||
miRNA Stemloop ID | hsa-mir-138-1 | ||||
Sequence | gcuacuucacaacaccagggcc | ||||
TTD Target(s) Regulated by This miRNA | Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [1] | |
Pyruvate dehydrogenase kinase 1 (PDHK1) | Clinical trial Target | Target Info | [2] | ||
Zinc finger E-box-binding homeobox 2 (ZEB2) | Literature-reported Target | Target Info | [3] | ||
References | |||||
REF 1 | MicroRNA-138 suppresses proliferation, invasion and glycolysis in malignant melanoma cells by targeting HIF-1. Exp Ther Med. 2016 Jun;11(6):2513-2518. | ||||
REF 2 | miR-138-1* regulates aflatoxin B1-induced malignant transformation of BEAS-2B cells by targeting PDK1. Arch Toxicol. 2016 May;90(5):1239-49. | ||||
REF 3 | MicroRNA-138 Regulates Metastatic Potential of Bladder Cancer Through ZEB2. Cell Physiol Biochem. 2015;37(6):2366-74. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.