miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-139-3p | ||||
| miRNA Stemloop AC | MI0000261 | ||||
| miRNA Stemloop ID | hsa-mir-139 | ||||
| Sequence | uggagacgcggcccuguuggagu | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-11 (MMP-11) | Literature-reported Target | Target Info | [1] | |
| ELAV-like protein 1 (ELAVL1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | RNA-binding protein NOB1 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | Dual tumor-suppressors miR-139-5p and miR-139-3p targeting matrix metalloprotease 11 in bladder cancer. Cancer Sci. 2016 Sep;107(9):1233-42. | ||||
| REF 2 | ICL-induced miR139-3p and miR199a-3p have opposite roles in hematopoietic cell expansion and leukemic transformation. Blood. 2015 Jun 18;125(25):3937-48. | ||||
| REF 3 | MiR-139-3p induces cell apoptosis and inhibits metastasis of cervical cancer by targeting NOB1.Biomed Pharmacother. 2016 Oct;83:850-856. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.