miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-141-5p | ||||
| miRNA Stemloop AC | MI0000457 | ||||
| miRNA Stemloop ID | hsa-mir-141 | ||||
| Sequence | caucuuccaguacaguguugga | ||||
| TTD Target(s) Regulated by This miRNA | Intercellular adhesion molecule ICAM-1 (ICAM1) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | C-Jun-amino-terminal kinase-interacting protein 4 | Regulated Protein | [2] | ||
| Serine/threonine-protein kinase WNK1 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5. | ||||
| REF 2 | Direct targeting sperm-associated antigen 9 by miR-141 influences hepatocellular carcinoma cell growth and metastasis via JNK pathway.J Exp Clin Cancer Res. 2016 Jan 21;35:14. | ||||
| REF 3 | The NF-B p65/miR-23a-27a-24 cluster is a target for leukemia treatment.Oncotarget. 2015 Oct 20;6(32):33554-67. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.