miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-146a-3p | ||||
| miRNA Stemloop AC | MI0000477 | ||||
| miRNA Stemloop ID | hsa-mir-146a | ||||
| Sequence | ccucugaaauucaguucuucag | ||||
| TTD Target(s) Regulated by This miRNA | C-X-C chemokine receptor type 4 (CXCR4) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Securin | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Upregulating miR-146a by physcion reverses multidrug resistance in human chronic myelogenous leukemia K562/ADM cells. Am J Cancer Res. 2016 Nov 1;6(11):2547-2560. | ||||
| REF 2 | PTTG1 regulated by miR-146a-3p promotes bladder cancer migration, invasion, metastasis and growth.Oncotarget. 2017 Jan 3;8(1):664-678. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.