miRNA General Information
miRNA Mature ID	hsa-miR-1470
miRNA Stemloop AC	MI0007075
miRNA Stemloop ID	hsa-mir-1470
Sequence	gcccuccgcccgugcaccccg
TTD Target(s) Regulated by This miRNA	Transcription factor AP-1 (JUN)	Discontinued Target	Target Info	[1]
References
REF 1	miR-1470 mediates lapatinib induced p27 upregulation by targeting c-jun. J Cell Physiol. 2015 Jul;230(7):1630-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.