miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-148a-5p | ||||
| miRNA Stemloop AC | MI0000253 | ||||
| miRNA Stemloop ID | hsa-mir-148a | ||||
| Sequence | aaaguucugagacacuccgacu | ||||
| TTD Target(s) Regulated by This miRNA | ATP-binding cassette transporter A1 (ABCA1) | Successful Target | Target Info | [1] | |
| RAC-beta serine/threonine-protein kinase (AKT2) | Literature-reported Target | Target Info | [2] | ||
| CDK inhibitor 1B p27Kip1 (CDKN1B) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Centromere protein F | Regulated Protein | [3] | ||
| Growth arrest-specific protein 1 | Regulated Protein | [5] | |||
| Homeobox protein TGIF2 | Regulated Protein | [6] | |||
| Perilipin-2 | Regulated Protein | [7] | |||
| References | |||||
| REF 1 | MicroRNA-148a regulates LDL receptor and ABCA1 expression to control circulating lipoprotein levels. Nat Med. 2015 Nov;21(11):1280-9. | ||||
| REF 2 | miR-148a suppresses human renal cell carcinoma malignancy by targeting AKT2. Oncol Rep. 2017 Jan;37(1):147-154. | ||||
| REF 3 | The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70. | ||||
| REF 4 | The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70. | ||||
| REF 5 | Induction of autophagy and apoptosis by miR-148a through the sonic hedgehog signaling pathway in hepatic stellate cells. Am J Cancer Res. 2015 Aug 15;5(9):2569-89. | ||||
| REF 6 | Down-Regulation of miR-148a Promotes Metastasis by DNA Methylation and is Associated with Prognosis of Skin Cancer by Targeting TGIF2.Med Sci Monit. 2015 Dec 6;21:3798-805. | ||||
| REF 7 | miR-148a and miR-30a limit HCV-dependent suppression of the lipid droplet protein, ADRP, in HCV infected cell models.J Med Virol. 2017 Apr;89(4):653-659. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.