miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-149-3p | ||||
| miRNA Stemloop AC | MI0000478 | ||||
| miRNA Stemloop ID | hsa-mir-149 | ||||
| Sequence | agggagggacgggggcugugc | ||||
| TTD Target(s) Regulated by This miRNA | Fibroblast growth factor receptor 1 (FGFR1) | Successful Target | Target Info | [1] | |
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [2] | ||
| E2F transcription factor 1 (E2F1) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Glypican-1 | Regulated Protein | [1] | ||
| Myb-related protein B | Regulated Protein | [2] | |||
| Proto-oncogene Wnt-1 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | Autoregulation of glypican-1 by intronic microRNA-149 fine tunes the angiogenic response to FGF2 in human endothelial cells. J Cell Sci. 2014 Mar 15;127(Pt 6):1169-78. | ||||
| REF 2 | miR-149* induces apoptosis by inhibiting Akt1 and E2F1 in human cancer cells. Mol Carcinog. 2010 Aug;49(8):719-27. | ||||
| REF 3 | Autoregulation of glypican-1 by intronic microRNA-149 fine tunes the angiogenic response to FGF2 in human endothelial cells. J Cell Sci. 2014 Mar 15;127(Pt 6):1169-78. | ||||
| REF 4 | miR-149* induces apoptosis by inhibiting Akt1 and E2F1 in human cancer cells. Mol Carcinog. 2010 Aug;49(8):719-27. | ||||
| REF 5 | 18-glycyrrhetinic acid suppresses gastric cancer by activation of miR-149-3p-Wnt-1 signaling.Oncotarget. 2016 Nov 1;7(44):71960-71973. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.