miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-149-5p | ||||
| miRNA Stemloop AC | MI0000478 | ||||
| miRNA Stemloop ID | hsa-mir-149 | ||||
| Sequence | ucuggcuccgugucuucacuccc | ||||
| TTD Target(s) Regulated by This miRNA | Fibroblast growth factor receptor 1 (FGFR1) | Successful Target | Target Info | [1] | |
| Interleukin-6 (IL6) | Successful Target | Target Info | [2] | ||
| Prostaglandin E2 receptor EP2 (PTGER2) | Successful Target | Target Info | [2] | ||
| Fibroblast growth factor-21 (FGF21) | Clinical trial Target | Target Info | [3] | ||
| Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [4] | ||
| Myeloid differentiation primary response protein MyD88 (MYD88) | Literature-reported Target | Target Info | [5] | ||
| Apoptosis antigen ligand (CD178) | Literature-reported Target | Target Info | [6] | ||
| Bcl-2-binding component 3 (BBC3) | Literature-reported Target | Target Info | [7] | ||
| Forkhead box protein M1 (FOXM1) | Literature-reported Target | Target Info | [8] | ||
| Protein(s) Regulated by This miRNA | ARF GTPase-activating protein GIT1 | Regulated Protein | [9] | ||
| Glypican-1 | Regulated Protein | [1] | |||
| Protein phosphatase 1F | Regulated Protein | [11] | |||
| Zinc finger and BTB domain-containing protein 2 | Regulated Protein | [12] | |||
| References | |||||
| REF 1 | Autoregulation of glypican-1 by intronic microRNA-149 fine tunes the angiogenic response to FGF2 in human endothelial cells. J Cell Sci. 2014 Mar 15;127(Pt 6):1169-78. | ||||
| REF 2 | Epigenetic silencing of microRNA-149 in cancer-associated fibroblasts mediates prostaglandin E2/interleukin-6 signaling in the tumor microenvironment. Cell Res. 2015 May;25(5):588-603. | ||||
| REF 3 | MiR-577 inhibits pancreatic -cell function and survival by targeting fibroblast growth factor 21 (FGF-21) in pediatric diabetes. Genet Mol Res. 2015 Dec 1;14(4):15462-70. | ||||
| REF 4 | miR-615-5p is restrictedly expressed in cirrhotic and cancerous liver tissues and its overexpression alleviates the tumorigenic effects in hepatocellular carcinoma. FEBS Lett. 2012 Sep 21;586(19):3309-16. | ||||
| REF 5 | MicroRNA-149 negatively regulates TLR-triggered inflammatory response in macrophages by targeting MyD88. J Cell Biochem. 2014 May;115(5):919-27. | ||||
| REF 6 | Inhibition of MicroRNA-149-5p Induces Apoptosis of Acute Myeloid Leukemia Cell Line THP-1 by Targeting Fas Ligand (FASLG). Med Sci Monit. 2016 Dec 25;22:5116-5123. | ||||
| REF 7 | A pre-microRNA-149 (miR-149) genetic variation affects miR-149 maturation and its ability to regulate the Puma protein in apoptosis. J Biol Chem. 2013 Sep 13;288(37):26865-77. | ||||
| REF 8 | miR-149 Inhibits Non-Small-Cell Lung Cancer Cells EMT by Targeting FOXM1. Biochem Res Int. 2013;2013:506731. | ||||
| REF 9 | MicroRNA-149 targets GIT1 to suppress integrin signaling and breast cancer metastasis.Oncogene. 2014 Sep 4;33(36):4496-507. | ||||
| REF 10 | Autoregulation of glypican-1 by intronic microRNA-149 fine tunes the angiogenic response to FGF2 in human endothelial cells. J Cell Sci. 2014 Mar 15;127(Pt 6):1169-78. | ||||
| REF 11 | miR-149 represses metastasis of hepatocellular carcinoma by targeting actin-regulatory proteins PPM1F.Oncotarget. 2015 Nov 10;6(35):37808-23. | ||||
| REF 12 | MicroRNA-149 inhibits proliferation and cell cycle progression through the targeting of ZBTB2 in human gastric cancer.PLoS One. 2012;7(10):e41693. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.