miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-152-5p | ||||
| miRNA Stemloop AC | MI0000462 | ||||
| miRNA Stemloop ID | hsa-mir-152 | ||||
| Sequence | agguucugugauacacuccgacu | ||||
| TTD Target(s) Regulated by This miRNA | Fibroblast growth factor-2 (FGF2) | Successful Target | Target Info | [1] | |
| Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | CD151 antigen | Regulated Protein | [1] | ||
| HLA class I histocompatibility antigen, alpha chain G | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | Long Noncoding RNA PVT1 Acts as a "Sponge" to Inhibit microRNA-152 in Gastric Cancer Cells. Dig Dis Sci. 2017 Nov;62(11):3021-3028. | ||||
| REF 2 | Helicobacter Pylori Promote B7-H1 Expression by Suppressing miR-152 and miR-200b in Gastric Cancer Cells. PLoS One. 2017 Jan 5;12(1):e0168822. | ||||
| REF 3 | Long Noncoding RNA PVT1 Acts as a "Sponge" to Inhibit microRNA-152 in Gastric Cancer Cells. Dig Dis Sci. 2017 Nov;62(11):3021-3028. | ||||
| REF 4 | Long non-coding RNA HOTAIR promotes HLA-G expression via inhibiting miR-152 in gastric cancer cells.Biochem Biophys Res Commun. 2015 Aug 28;464(3):807-13. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.