miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-153-3p | ||||
| miRNA Stemloop AC | MI0000463 | MI0000464 | ||||
| miRNA Stemloop ID | hsa-mir-153-1 | hsa-mir-153-2 | ||||
| Sequence | uugcauagucacaaaagugauc | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [2] | ||
| Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | E3 ubiquitin-protein ligase HECTD3 | Regulated Protein | [4] | ||
| Krueppel-like factor 5 | Regulated Protein | [5] | |||
| Peroxiredoxin-2 | Regulated Protein | [6] | |||
| Zinc finger protein SNAI1 | Regulated Protein | [7] | |||
| References | |||||
| REF 1 | miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9. | ||||
| REF 2 | mir-29 regulates Mcl-1 protein expression and apoptosis. Oncogene. 2007 Sep 13;26(42):6133-40. | ||||
| REF 3 | Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem. 2009 Aug 28;284(35):23204-16. | ||||
| REF 4 | MiR-153 promotes breast cancer cell apoptosis by targeting HECTD3. Am J Cancer Res. 2016 Jul 1;6(7):1563-71. | ||||
| REF 5 | MicroRNA-153 inhibits the proliferation and invasion of human laryngeal squamous cell carcinoma by targeting KLF5. Exp Ther Med. 2016 Jun;11(6):2503-2508. | ||||
| REF 6 | A Proteomics Approach to Investigate miR-153-3p and miR-205-5p Targets in Neuroblastoma Cells.PLoS One. 2015 Dec 3;10(12):e0143969. | ||||
| REF 7 | Downregulation of miR-153 contributes to epithelial-mesenchymal transition and tumor metastasis in human epithelial cancer.Carcinogenesis. 2013 Mar;34(3):539-49. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.