miRNA General Information
miRNA Mature ID hsa-miR-154-3p
miRNA Stemloop AC MI0000480
miRNA Stemloop ID hsa-mir-154
Sequence aaucauacacgguugaccuauu
TTD Target(s) Regulated by This miRNA Wnt-5a protein (WNT5A) Literature-reported Target Target Info [1]
References
REF 1 MicroRNA-154 functions as a tumor suppressor in osteosarcoma by targeting Wnt5a. Oncol Rep. 2016 Mar;35(3):1851-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.