miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-154-3p | ||||
miRNA Stemloop AC | MI0000480 | ||||
miRNA Stemloop ID | hsa-mir-154 | ||||
Sequence | aaucauacacgguugaccuauu | ||||
TTD Target(s) Regulated by This miRNA | Wnt-5a protein (WNT5A) | Literature-reported Target | Target Info | [1] | |
References | |||||
REF 1 | MicroRNA-154 functions as a tumor suppressor in osteosarcoma by targeting Wnt5a. Oncol Rep. 2016 Mar;35(3):1851-8. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.