miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-15a-3p | ||||
| miRNA Stemloop AC | MI0000069 | ||||
| miRNA Stemloop ID | hsa-mir-15a | ||||
| Sequence | caggccauauugugcugccuca | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| Mixed lineage kinase 1 (MAP3K9) | Clinical trial Target | Target Info | [2] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Twist-related protein 1 | Regulated Protein | [4] | ||
| References | |||||
| REF 1 | MiR-15a/16 regulates the growth of myeloma cells, angiogenesis and antitumor immunity by inhibiting Bcl-2, VEGF-A and IL-17 expression in multiple myeloma. Leuk Res. 2016 Oct;49:73-9. | ||||
| REF 2 | Role of miR-15a in intervertebral disc degeneration through targeting MAP3K9. Biomed Pharmacother. 2017 Mar;87:568-574. | ||||
| REF 3 | miR-15a/miR-16 induces mitochondrial dependent apoptosis in breast cancer cells by suppressing oncogene BMI1. Life Sci. 2016 Nov 1;164:60-70. | ||||
| REF 4 | miR-15a-3p and miR-16-1-3p Negatively Regulate Twist1 to Repress Gastric Cancer Cell Invasion and Metastasis.Int J Biol Sci. 2017 Jan 15;13(1):122-134. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.