miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-16-1-3p | ||||
| miRNA Stemloop AC | MI0000070 | ||||
| miRNA Stemloop ID | hsa-mir-16-1 | ||||
| Sequence | ccaguauuaacugugcugcuga | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| Interleukin-17 (IL17) | Successful Target | Target Info | [1] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [1] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [2] | ||
| G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | G1/S-specific cyclin-D2 | Regulated Protein | [4] | ||
| Twist-related protein 1 | Regulated Protein | [5] | |||
| V-type immunoglobulin domain-containing suppressor of T-cell activation | Regulated Protein | [6] | |||
| Zyxin | Regulated Protein | [7] | |||
| References | |||||
| REF 1 | MiR-15a/16 regulates the growth of myeloma cells, angiogenesis and antitumor immunity by inhibiting Bcl-2, VEGF-A and IL-17 expression in multiple myeloma. Leuk Res. 2016 Oct;49:73-9. | ||||
| REF 2 | Truncation in CCND1 mRNA alters miR-16-1 regulation in mantle cell lymphoma. Blood. 2008 Aug 1;112(3):822-9. | ||||
| REF 3 | Down-regulation of the cyclin E1 oncogene expression by microRNA-16-1 induces cell cycle arrest in human cancer cells. BMB Rep. 2009 Nov 30;42(11):725-30. | ||||
| REF 4 | c-Myc Represses Tumor-Suppressive microRNAs, let-7a, miR-16 and miR-29b, and Induces Cyclin D2-Mediated Cell Proliferation in Ewing's Sarcoma Cell Line.PLoS One. 2015 Sep 22;10(9):e0138560. | ||||
| REF 5 | miR-15a-3p and miR-16-1-3p Negatively Regulate Twist1 to Repress Gastric Cancer Cell Invasion and Metastasis.Int J Biol Sci. 2017 Jan 15;13(1):122-134. | ||||
| REF 6 | Alterations in microRNA expression profiles in inflamed and noninflamed ascending colon mucosae of patients with active Crohn's disease.J Gastroenterol Hepatol. 2017 Oct;32(10):1706-1715. | ||||
| REF 7 | MiR-16-1 plays a role in reducing migration and invasion of glioma cells.Anat Rec (Hoboken). 2013 Mar;296(3):427-32. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.