miRNA General Information
miRNA Mature ID	hsa-miR-16-2-3p
miRNA Stemloop AC	MI0000115
miRNA Stemloop ID	hsa-mir-16-2
Sequence	ccaauauuacugugcugcuuua
TTD Target(s) Regulated by This miRNA	Retinoic acid receptor beta (RARB)	Successful Target	Target Info	[1]
References
REF 1	Prognostic significance of differentially expressed miRNAs in esophageal cancer. Int J Cancer. 2011 Jan 1;128(1):132-43.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.