miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-181d-3p | ||||
| miRNA Stemloop AC | MI0003139 | ||||
| miRNA Stemloop ID | hsa-mir-181d | ||||
| Sequence | ccaccgggggaugaaugucac | ||||
| TTD Target(s) Regulated by This miRNA | Interleukin 1 receptor type 1 (IL1R1) | Successful Target | Target Info | [1] | |
| C-C chemokine receptor type 1 (CCR1) | Clinical trial Target | Target Info | [1] | ||
| References | |||||
| REF 1 | Identification of IGF-1-enhanced cytokine expressions targeted by miR-181d in glioblastomas via an integrative miRNA/mRNA regulatory network analysis. Sci Rep. 2017 Apr 7;7(1):732. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.