miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-181d-5p | ||||
| miRNA Stemloop AC | MI0003139 | ||||
| miRNA Stemloop ID | hsa-mir-181d | ||||
| Sequence | aacauucauuguugucggugggu | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| O-6-methylguanine-DNA-alkyltransferase (MGMT) | Clinical trial Target | Target Info | [2] | ||
| GTPase HRas (HRAS) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Mucosa-associated lymphoid tissue lymphoma translocation protein 1 | Regulated Protein | [4] | ||
| Ras-related protein Rap-1b | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. | ||||
| REF 2 | miR-181d: a predictive glioblastoma biomarker that downregulates MGMT expression. Neuro Oncol. 2012 Jun;14(6):712-9. | ||||
| REF 3 | MiR-181d acts as a tumor suppressor in glioma by targeting K-ras and Bcl-2. J Cancer Res Clin Oncol. 2012 Apr;138(4):573-84. | ||||
| REF 4 | miR-181d/MALT1 regulatory axis attenuates mesenchymal phenotype through NF-B pathways in glioblastoma.Cancer Lett. 2017 Jun 28;396:1-9. | ||||
| REF 5 | miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells.Med Oncol. 2014 Apr;31(4):892. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.