miRNA General Information
miRNA Mature ID	hsa-miR-188-3p
miRNA Stemloop AC	MI0000484
miRNA Stemloop ID	hsa-mir-188
Sequence	cucccacaugcaggguuugca
TTD Target(s) Regulated by This miRNA	Signal transduction protein CBL (CBL)	Literature-reported Target	Target Info	[1]
References
REF 1	Overexpression of X-linked genes in T cells from women with lupus. J Autoimmun. 2013 Mar;41:60-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.